Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 12,721-12,74012,741-12,76012,761-12,780 ... 18,721-18,725 next last

Launch halted at t-40 seconds - problem with Booster not resolved - will try again tomorrow at earliest.


12,741 posted on 03/03/2025 3:55:54 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12740 | View Replies]

To: PIF
🍈

Hey PIF, this one is for you!!


12,742 posted on 03/03/2025 4:08:14 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12741 | View Replies]

To: PIF; SpeedyInTexas

“Starship Flight”

I am thinking about doing a little tourism in Texas this year, with my old Army buddy whom I served with in Afghanistan.

Looking for things to see and do for a week or two of road trip and/or guided tours.

Seeing a launch at Boca Chica would be cool (or NASA in Houston). Is there a website where they project the launches (understanding that schedules will likely change)?

What other highlights of Texas might be cool? Rodeos? Rafting Big Bend National Park? Alamo? Spring Break in South Padre Island? Slipping into Mexico for a bullfight?


12,743 posted on 03/03/2025 5:19:23 PM PST by BeauBo ( )
[ Post Reply | Private Reply | To 12738 | View Replies]


12,744 posted on 03/03/2025 7:03:31 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12743 | View Replies]


12,745 posted on 03/03/2025 7:04:09 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12744 | View Replies]

To: JonPreston

12,746 posted on 03/03/2025 7:04:39 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12745 | View Replies]


12,747 posted on 03/03/2025 7:05:11 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12746 | View Replies]


12,748 posted on 03/03/2025 7:05:47 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12747 | View Replies]

To: JonPreston

12,749 posted on 03/03/2025 7:06:31 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12748 | View Replies]

To: JonPreston

12,750 posted on 03/03/2025 7:07:06 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12749 | View Replies]

To: JonPreston
🍈


12,751 posted on 03/03/2025 7:07:44 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12750 | View Replies]

To: gleeaikin

Russian Offensive Campaign Assessment, March 3, 2025

Ukrainian military intelligence indicated that about 620,000 Russian soldiers are operating in Ukraine and Kursk Oblast, an increase of about 40,000 personnel compared to late 2024. Ukrainian Main Military Intelligence Directorate (GUR) Deputy Head Major General Vadym Skibitskyi stated in an interview with RBK-Ukraine published on March 3 that there are 620,000 Russian soldiers in Ukraine and Kursk Oblast, about 200,000 of whom are actively fighting on the frontline.[1] Skibitskyi stated that there are roughly 35,000 additional Rosgvardia troops protecting rear areas and that these personnel can become a second line of defense if necessary. Skibitskyi stated in November 2024 there were about 580,000 Russian soldiers operating against Ukraine (presumably both within Ukraine and in Kursk Oblast), and Ukrainian President Volodymyr Zelensky stated in January 2025 that the total Russian force grouping in Ukraine was about 600,000 troops.[2]

Russian missile production has reportedly not significantly increased, but Russian forces appear to be prioritizing production of missile and drone variants that are more effective against Ukrainian air defenses. Skibitskyi stated that Russia has marginally increased its missile production by a factor of 1.2 to 1.5 throughout 2024 and is “redistributing” its production capabilities.[17] Skibitskyi stated that Russian forces are producing more Kh-101 cruise missiles and fewer of the less effective Kalibr cruise missiles and intend to produce more Kinzhal and Iskander-M ballistic missiles in the near future. Russian forces rarely used Kalibr cruise missiles in strike packages against Ukraine in January or February 2025 and continue to mainly use Kalibr missiles to pad larger strike packages and overwhelm Ukrainian air defenses.[18]

The GUR reported on February 18 that Russia is modernizing and increasing its production of Shahed-136 drones and producing a new Geran-3 drone variant.[19] The GUR reported that Russia has equipped some new Shahed-136 (”Geran-2”) drones with a new type of warhead weighing 90 kilograms, moved the drones’ navigation and power systems from the nose to the tail, and installed an additional ballast to help with the drones’ stability. The GUR reported that Russia is increasingly relying on components manufactured in Russia, the People’s Republic of China (PRC), and Iran to produce and assemble Shahed drones. The GUR reported that the Geran-3 drone is an analogue to the Shahed-238 and can fly at a speed of up to 550 to 600 kilometers per hour and has a range of 2,500 kilometers. ISW previously assessed that Russia likely intended to further increase its production and use of Shahed drones and other Shahed-variants following the signing of the Russian-Iranian Comprehensive Strategic Partnership Agreement in January 2025.[20]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-march-3-2025


12,752 posted on 03/03/2025 10:54:49 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12707 | View Replies]

To: BeauBo

Went to NASA a number of years ago. One thing that I remember was how small the control room used for moon landings was.

Been to the Alamo. Touristy, but went. If you go to San Antonio, have lunch or dinner on the River Walk. Lived in San Antonio for 4 years.

Starship Launch Schedule: https://rocketlaunch.org/launch-schedule/spacex/starship


12,753 posted on 03/03/2025 11:05:04 PM PST by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 12743 | View Replies]

Day 1104 of the Russian invasion. 1,340, i.e. more than 55 Russians and Norks/h. Vehicles and fuel tanks more than 180% and artillery more than 105% above the average.


12,754 posted on 03/04/2025 2:10:14 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12709 | View Replies]

To: SpeedyInTexas; PIF
Кремлевская табакерка

Pleasant chaos, but a lot that is unclear.” Federal TV expects new instructions from the Kremlin regarding Trump

The sharp rapprochement between Russia and the United States , which began after Donald Trump returned to the White House, has become too fast. Even for experienced media people. We talked to several prominent employees of the federal media and found out what they think about everything that is happening and how their communication with the Presidential Administration has changed in the new conditions. “By and large, there is real chaos. It is mostly pleasant, because Trump is obviously ready to end the conflict on our terms. But he says one thing, while you are preparing for the broadcast, they bring completely different theses. It is difficult to work, but overall it is acceptable,” the host of one of the political shows on federal TV told us.

The interlocutor, who is engaged in the preparation of news broadcasts, noted that Trump's behavior has mixed up many cards, and it is necessary to quickly react to changes in the agenda. “You see, yesterday the Americans were our sworn enemies, and the Ukrainians were their puppets. Now the US is already friends and respected partners. The AP [Presidential Administration] says not to praise Trump too much, but also not to saturate the broadcasts with negativity towards him. To be honest, I think the Kremlin itself did not really expect such a sharp turn of events,” said the channel's source.

Alexey Gromov’s entourage from the AP is reluctant to give comments. Our old comrade said that now there is too much work in the American direction. If questions arise, media executives are advised to avoid excessive initiative and present the news in a neutral light. “Everyone is in a fairly upbeat mood, but there is no final position on a number of issues. For example, we have been saying for years that the West and the Americans want to steal our resources . And now we have to explain to ordinary Russians why this is a good deal for us. On the other hand, the sanctions were laughed at, they said that they do not work. And if they start lifting them, will we have to praise Trump or what? It is more correct, of course, to praise Vladimir Vladimirovich, but there is still a lot that is unclear about Trump, that is true,” said a source close to Gromov.

https://t.me/kremlin_secrets/5366

12,755 posted on 03/04/2025 3:08:08 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12753 | View Replies]

To: BeauBo

Starship currently launches from Boca Chica only, But they are building a similar facility at the Cape. The Cape facility will feature a Starship factory the links directly with the Gigafactory which will be gigantic cube 360 feet high so that parts come directly from the factory to the assembly factory. this is to facilitate to projected 25 launches per year, until they can go to launches per day.

Texas highlights - PM Speedy he’d know.

Slipping into Mexico for any reason is not advisable - see cartel control and violence. Remember you are from the country that just cut off a major source of their funding and declared them terrorist orgs.

all things SpaceX
https://www.spacex.com/


12,756 posted on 03/04/2025 4:22:49 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12743 | View Replies]

To: FtrPilot

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Massive Upgrade! Ukrainians Unleash Hell on Russian Aviation! ]

Today [ Mar 03, 8 pm ], there is interesting news from Toretsk.

Here, the newly received MANPADS from Sweden allowed Ukrainian forces to turn the tide in Toretsk by creating a lethal threat to Russian aviation.

As Ukrainian fighters began shooting down Russian aircraft, they not only disrupted enemy air support, but also forced Russian forces to scale back their countermeasures, allowing Ukraine to push deeper into the contested town.

With the battle for Toretsk coming to a critical point, Ukrainian forces are determined to maintain their foothold on the edges of the settlement, and prevent Russian attempts to break out and advance into more open terrain.

Ukrainian presence in the ruins of Toretsk not only prevents Russian forces from fully consolidating control, but also keeps the possibility of Ukrainian counteroffensives alive, with persistent counterattacks effectively draining Russian manpower and resources, in brutal urban combat.

These strikes prevent Russian forces from regrouping and fortifying their gains, keeping the battle dynamic and forcing the enemy into a constant state of attrition.

At the same time, Ukraine’s effective use of drones has severely limited Russian mobility, making it dangerous for their infantry to move through the shattered remains of the town. Every Russian advance is met with drone surveillance and precision strikes, ensuring that their movements are neither unnoticed nor unpunished.

Unlike previous months, when weak spots could be exploited, Ukrainian positions here now are solidified, leaving little room for Russian infiltration. As Russian attempts to encircle Toretsk failed, this allowed Ukrainian defenders to maintain direct supply routes, without significant disruptions.

In addition, the Ukrainian brigades engaged in the area are notably better trained and equipped than the Russian units thrown into the fight, consisting mainly of mobilized personnel from Donetsk and Lugansk oblast with lower combat morale.

This has forced Russian commanders to increasingly rely on airstrikes, in an attempt to bomb Ukrainians out of their positions. The frontline situation has prevented Ukraine from positioning its long-range air defense systems closer to Toretsk, giving Russian jets the ability to operate more freely close to the front.

Without immediate threats from advanced anti-air systems, Russian aircraft have dared to fly closer to provide direct fire support, posing a serious challenge to the Ukrainians.

Recognizing the need to counter Russian airpower, Ukrainian forces have begun to deploy man-portable air defense systems as an effective ambush tool. Unlike stationary long-range systems, they are small, mobile, and difficult to detect, allowing operators to fire from concealed positions before relocating, and with inflow of MANPADS from Sweden, Ukrainians could start using them more freely. The Russians, emboldened by the lack of Ukrainian long-range air defenses near Toretsk, unknowingly flew into this trap.

A geolocated video from the area shows Ukrainian fighters monitoring a pair of Russian SU-25 attack aircraft before launching an anti-air missile from an Igla MANPAD and successfully shooting one of the planes down. This not only disrupted Russian air support in the area, but also created additional problems.

Soon, a Russian Mi-8 helicopter was dispatched to evacuate the downed pilot, which the Ukrainians expected as they launched FPV drones that quickly targeted it, forcing it to abandon the mission and leave the evacuation team behind.

Although the Russian helicopter managed to escape, due to its electronic warfare system, it is still unknown if it suffered any damage from the drones, highlighting Russia’s vulnerabilities, and making it clear that air operations near Toretsk had become increasingly dangerous.

This had immediate consequences, as the fearful Russian aviation reduced its presence in the area, allowing Ukrainian forces to intensify their raids into the town, pushing the gray zone further back into it, as can be seen in several recently released videos. They showcased the work of Ukrainian special forces, disembarking from armored vehicles on the outskirts of Toretsk, and destroying various enemy soldiers and hideouts.

Overall, the successful use of man-portable air-defense systems in Toretsk has proven how crucial they are for frontline operations. While Ukraine’s Western allies have been supplying high-end systems like Patriot to protect critical infrastructure and rear positions, new deliveries of MANPADS from Sweden will provide even more tactical flexibility to Ukrainian forces on the frontlines.

These additional weapons will allow them to continue denying Russian air superiority in contested areas like Toretsk, forcing Russian pilots to operate at greater risk or at longer distances, abandoning close air support altogether.


12,757 posted on 03/04/2025 4:56:38 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12756 | View Replies]

To: PIF; FtrPilot; USA-FRANCE; gleeaikin
PIF: "Say goodbye to TSMC, along with most new gadgets, cars, phones, computers, and smart anything.
The US will have to buy them from China - if they will sell any to us."

Yesterday -- Trump & Wei:

I don't think so because:

  1. Yesterday, Pres. Trump had the chairman of TSMC, CC Wei, at the White House to announce $165 billion in total TSMC investments, mainly in Arizona, to build its most advanced chips there.

  2. Another major investment announcement came from Apple -- $500 billion in AI servers and advanced manufacturing, mainly in Texas.

  3. OpenAI has also announced $500 billion investments in new AI infrastructure, largely in Texas.

  4. Saudi Arabia has pledged $600 billion (perhaps $1 trillion?) in US technology, infrastructure and trade.

  5. Several other new investments have also been announced, including:

    • Meta -- $30 billion for data centers across the US
    • Oracle -- $20 billion for US data centers

  6. Somewhere I saw a number of $1.7 trillion as the total of new investments in the US, just so far under Trump #47.

  7. As for outsourcing to China, no, that's what Trump is taking us away from -- no more dependence on hostile countries for critical raw materials & advanced products: put American manufacturing first.
At least, that's the plan.

BTW, did anyone here report on the US State Department removing a statement from its website saying the US does not support independence for Taiwan.

PIF: "Soon we will see 47 aligning US foreign & monetary policy with the BRICS nations."

Pres. Trump's recent comments regarding BRICS have been very much in the opposite direction.

Apple CEO Cook with Pres. Trump, Austin, Texas:

12,758 posted on 03/04/2025 5:45:38 AM PST by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 12711 | View Replies]

To: PIF

In just a week near Kreminna and the Serebryanskyy forest, Ukrainian border guards’ PHOENIX unit turned Russian equipment into scrap. Destroyed: a BTR-80, a makeshift bridge, an Msta-B howitzer, 13 military vehicles, a Mavic drone, and 2 relay stations.

https://bsky.app/profile/noelreports.com/post/3ljkl5gvqb22i

1 min video


12,759 posted on 03/04/2025 5:46:08 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12757 | View Replies]

To: gleeaikin; PIF; GBA; blitz128; FtrPilot; BeauBo; USA-FRANCE; marcusmaximus; ETCM; SpeedyInTexas
Ukraine has two ICEYE satellites at its disposal. The capabilities of the first were purchased, in particular, for UAH 600 million donated by Ukrainians, the second - with funds from Rheinmetall and the German government. Importantly, the company provides Ukrainian intelligence with the ability to receive images from the entire satellite network.

There is a big difference between “owning” satellites and having access to imagery from the entire fleet. One satellite makes an average of 2.5 effective flights per day over the territory of Ukraine. These capabilities are guaranteed to be assigned to the owner. Intelligence can use its two satellites and at any time receive data about the area of ​​​​interest to them.

ICEYE’s devices are special in that they do not photograph the surface, but use Synthetic aperture radar (SAR) technology. From an altitude of 500 km, they launch radar waves to the Earth, which are reflected from objects and received back, thereby creating the most detailed picture of what is happening on the surface. Radar waves can penetrate clouds and even some shelters, so the GUR quickly obtains images from anywhere on the planet, including at night.


SAR image of Russian ships in the bay


SAR image of Russian S300/400 air defense missile systems positions


SAR image of a Russian oil refinery

https://epravda.com.ua/oborona/yak-pracyuye-narodniy-suputnik-novi-detali-ta-foto-803930/

12,760 posted on 03/04/2025 6:04:34 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12759 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 12,721-12,74012,741-12,76012,761-12,780 ... 18,721-18,725 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson