Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 12,001-12,02012,021-12,04012,041-12,060 ... 22,081-22,088 next last
To: PIF; BroJoeK

12,021 posted on 02/15/2025 3:52:22 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 50 | View Replies]

To: BroJoeK

Russian Foreign Minister Sergey Lavrov, and Sec. of State Marco Rubio, just had phone call by request of Trump admin.

They reportedly discussed:

-End of conflict in Ukraine
-Plan for Palestinians and Middle East
-Normalizing trade relations and reversing Obama/Biden policy… pic.twitter.com/LIb3xhC95o— Clandestine (@WarClandestine) February 15, 2025

Russian Foreign Minister Sergey Lavrov, and Sec. of State Marco Rubio, just had phone call by request of Trump admin.

They reportedly discussed:

-End of conflict in Ukraine
-Plan for Palestinians and Middle East
-Normalizing trade relations and reversing Obama/Biden policy
-Maintaining channel for communications

Trump is not only negotiating an end to WW3, he is completely changing the relationship between the US and Russia. Trump and Putin recognize that the Deep State is the enemy, not each other.

This is an extremely positive sign. This means nukes will not be flying, and WW3 is about to be cancelled. The future is starting to look a lot more peaceful.


12,022 posted on 02/15/2025 4:23:33 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12021 | View Replies]

To: blitz128

😂🦆


12,023 posted on 02/15/2025 5:30:05 PM PST by blitz128
[ Post Reply | Private Reply | To 12019 | View Replies]

To: gleeaikin

Russian Offensive Campaign Assessment, February 15, 2025

Russian cargo vessels have continued to evacuate military assets from the port of Tartus as Russia negotiates its presence in Syria with the interim government. NOTE: A version of this text also appears in ISW-CTP’s February 15 Iran Update. OSINT analyst MT Anderson posted satellite imagery from February 14 showing the Russian cargo vessel Baltic Leader and potentially the Admiral Golovko Admiral Gorshkov-class frigate about 250 kilometers south of the coast of southwestern Cyprus.[37] Anderson said that the Baltic Leader departed the port of Tartus sometime after February 4, when satellite imagery showed the vessel at the port.[38] It is unclear at this time if the Baltic Leader will bring evacuated Russian cargo to Russia or Libya. Russia sent some assets from Syria to Libya by air in December 2024 and January 2025.[39] Publicly available marine tracking data showed that two cargo vessels that departed Tartus in late January, the Sparta and Sparta II, were sailing off the coast of the Netherlands on February 15, presumably in transit to Russia.[40] Continued Russian-Syria engagement — including a recent phone call between Syrian Interim President Ahmed al Shara and Russian President Vladimir Putin — suggests that Syria seeks some relationship with Russia even as Russia withdraws its military assets from Syria.[41] Russian Ministry of Foreign Affairs spokesperson Maria Zakharova said on February 14 that Russia continues to discuss its military presence in Syria with the new Syrian administration.[42]

Russian advances may be slowing south of Pokrovsk due to degradation among frontline Russian units and intensified Ukrainian drone operations in the area. Ukraine’s Khortytsia Group of Forces Spokesperson Major Viktor Trehubov reported on February 11 that Russian forces suffered roughly 7,000 personnel killed in action (KIA) in the Pokrovsk direction in January 2025, and Ukrainian Commander-in-Chief General Oleksandr Syrskyi stated on February 2 that Russian forces suffered 15,000 total casualties in this direction in January 2025.[29] Russian forces have suffered significant personnel losses throughout the frontline in the past five and a half months and have likely suffered most of these losses in the Pokrovsk direction.[30] Such losses are likely negatively impacting the combat effectiveness of Russian units in the area.

A Russian milblogger and former Storm-Z instructor claimed on February 15 that Ukrainian drone operations are significantly impeding Russian activity in the Pokrovsk direction.[31] The milblogger claimed that Ukrainian drones are striking any Russian forces operating more than three kilometers north and west of Selydove (currently 11 kilometers south and 35 kilometers east of the frontline) and that Ukrainian drones are monitoring and restricting access to all roads in this direction. The milblogger claimed that Ukrainian drones are making it “impossible” for Russian forces to conduct rotations or resupply frontline units and that Russian activity south and southwest of Pokrovsk is currently very challenging. The milblogger suggested that Ukrainian forces have created a strong layered defense comprised of minefields, conventional artillery systems, and strike and reconnaissance drones and are successfully integrating reconnaissance from drones with ground-based fire systems to improve Ukrainian strike capabilities in the area. The milblogger expressed concern that Russia is far from reaching parity with Ukrainian drone operations and noted that excessive Russian formalization efforts have stalled the development of Russia’s drone capabilities.

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-february-15-2025


12,024 posted on 02/16/2025 1:44:55 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11965 | View Replies]


12,025 posted on 02/16/2025 1:50:14 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11774 | View Replies]


12,026 posted on 02/16/2025 1:51:13 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12025 | View Replies]

1,730 i.e. more than 72 Russians and Norks/h. Vehicles and fuel tanks more than 100% above the average.


12,027 posted on 02/16/2025 2:01:45 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11966 | View Replies]

To: blitz128; PIF
Кремлевская табакерка

“I feel sorry for the old fool who decided to sing at the “peace concert” in Moscow.” What you need to know about the negotiations on Ukraine

After the Munich Security Conference and, in fact, the launch of negotiations to resolve the Ukrainian crisis, there are even more questions than before about what these negotiations might be like. And what their outcome will be. We tell you what you should know about this at the moment.

Firstly, there will be negotiations. What exactly and how they will go, no one can say yet. But the process has already been effectively launched.

Secondly, the negotiations, unfortunately, have already begun to split our elites. We wrote : the hawks are afraid and warn that the SVO will now not end with any Victory. And they are even beginning to ask the question: what was the point of it all? Their opponents are confident in the success of the negotiations and are already noting Vladimir Putin's achievements. Thank God, there is no major conflict yet, but it is quite possible. Plus, there are splits along a number of other lines, which we will remain silent about for now in the hope of improving the situation.

Thirdly, the Munich Conference added to the confusion. “On the one hand, the Americans really screwed Europe over there. That plays into our hands, Vance can be praised. On the other hand, much of what Trump's special representative Kellogg said is unacceptable. What kind of tightening of sanctions against Russia is this? What kind of concessions are Vladimir Vladimirovich making? Strange words,” our source in the Kremlin noted.

In general, opinions have become even more divided after Munich. Some believe that our president will have several conversations with Trump, and “the American will understand everything correctly.” Others expect even more problems from the United States than Biden created for us. The fog is thickening. This state of affairs was best expressed by another source of the channel in the Kremlin. “Italian singer Al Bano is supposedly planning to go to Moscow at the end of the summer to sing at a “peace concert” in honor of the end of the Second World War. It's a shame for the old fool. The concert may well not take place, and I think the singer has already been promised a couple of million rubles. That's all I can tell you about my expectations from the negotiations,” he explained.

https://t.me/kremlin_secrets/5298

12,028 posted on 02/16/2025 2:18:23 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12023 | View Replies]

Кремлевская табакерка:
Mobilization will not help here. Is it true that our army has big problems in the Pokrovsky direction?

We have been asked this question at least several dozen times. The reason is this and several other posts. We did not want to write about it. We have known for a long time, including from the military who are there, about the difficulties in the Pokrovsky direction. We contacted the Ministry of Defense, the generals close to Valery Gerasimov. As you can see, they did not listen. Neither us, nor anyone else. That is why such information appears, and the military says: “We have no strength, we do not know what else to do.”

We are forced to add a few more details, maybe after this they will listen to us. Just two facts. Firstly, every day in the Pokrovsky direction from 120 to 300 of our soldiers are killed or wounded, often seriously . Think about these numbers ... Secondly, many of the wounded die because they do not receive timely medical care. The enemy with its drones and other weapons often does not even allow the wounded to be taken from the battlefield. And nothing can be done about it yet.

Esteemed military leadership! We are no longer asking, but demanding that the problems be solved. You know about them very well. We understand that you have chosen the approach of “ we will demand mobilization and cover up all our mistakes by saying that it is not being carried out now.” But that won't work! There are situations in which mobilization will not help. You just need to make decisions and listen when they tell you about the problems. And admit your mistakes, of course. Sorry, but if you don't hear, we and our colleagues will make information about several more sensitive issues public. We are sure you don't want that.

https://t.me/kremlin_secrets/5299

12,029 posted on 02/16/2025 2:25:33 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12028 | View Replies]

To: marcusmaximus

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Russians in a Headlock! Offensive Stuck in a Hopeless Position! ]

Today [ Feb 15, 8 pm ], there are interesting updates from the Pokrovsk direction.

Here, the Russians are in a hurry to secure the village of Udachne as part of their offensive to encircle Pokrovsk from the west.

Despite stepping up their efforts with countless infantry attacks, the Russian assault started faltering in front of the well-prepared Ukrainian defense.

The main Russian goal is to capture Udachne, which proves critical, if they want to advance on the western flank of Pokrovsk, as this would secure their flank against Ukrainian counterattacks. To achieve this, Russian troops have focused on moving through the local tree lines, using them as cover while advancing.

A key tactical advantage lies in the tree line near the local railway, which connects directly to the village. If Russian forces secure this position, they could flow directly into Udachne, giving them a staging ground for further advances.

At the same time, the Russian approach is severely limited by the terrain. The only available attack routes pass through two long, narrow tree lines, fully exposed to Ukrainian direct fire for nearly their entire length. The lack of crossing points over the local river, prevents Russian forces from using armored vehicles for support, forcing them to rely exclusively on infantry.

Without a secure staging area, Russian forces are forced to attack in small groups, otherwise risking even earlier detection of larger groups and even bigger casualties, resulting in a non-stop, but controllable stream of Russian soldiers for Ukrainians to deal with.

Another critical disadvantage for the Russians becomes clear if we look at the topographic map. Ukrainian positions near Udachne sit on higher ground, giving them a clear line of sight over Russian forces advancing from the south.

Russian armor positioned further back cannot provide adequate direct fire support because Ukrainian positions are outside their line of sight. Meanwhile, Ukrainian forces enjoy superior logistics, with secure supply routes from Mezhova and the Pokrovsk-Dnipro highway. These routes allow for the efficient rotation of troops and resupply of ammunition, reinforcing these positions without interruption.

With constant drone surveillance monitoring the battlefield, Ukrainian defenders can track Russian troop movements in real-time, allowing them to strike Russian infantry formations as soon as they enter the tree lines.

Additionally, due to the small size of each Russian group, Ukrainians have been able to repel them using relatively simple, but highly effective means. Mortars, FPV drones, and small arms fire have been enough to neutralize the attacks, before they can reach Ukrainian positions.

Drone footage shows Russian infantry attempting to advance through the narrow tree lines, only to be met with precise artillery fire and drone-dropped grenades. Each group that tries to establish a foothold is quickly eliminated before they can secure even temporary shelter.

The aftermath of these failed assaults is visible, with one video showing Ukrainian soldiers clearing a tree line after repelling an attack, ensuring that no Russian survivors remain to launch ambushes. In another clip, Russian infantry is attempting to move through open ground, only to be destroyed by mortar fire.

Another video captures the final moments of a Russian soldier who, hearing an approaching drone, decides to detonate his grenade, rather than face an inevitable death. These scenes highlight the desperation among Russian troops, who are being sent into battle with little hope of success. Despite continuous reinforcements, mainly composed of newly recruited contract soldiers who signed up in December, the Russian effort to take Udachne remains an unsuccessful and costly endeavor.

Overall, the failure to capture Udachne has significantly weakened the Russian offensive west of Pokrovsk. Despite relentless assaults, Russian forces have been unable to establish a foothold in the village, with each attack resulting in heavy losses. Meanwhile, Ukrainian forces, benefiting from superior logistics and a well-coordinated defense, have successfully repelled the constant, but manageable stream of Russian infantry.

Superior logistics has also allowed Ukrainians to rotate a newly formed brigade off the front line here after they gained their first combat experience, deploying a more experienced and battle-tested unit to take its place, further improving the effectiveness of Ukrainian defenses.

As Russian forces continue to suffer attrition, without gaining meaningful ground, the prospect of encircling Pokrovsk from the west is becoming increasingly unlikely.


12,030 posted on 02/16/2025 2:27:34 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 12016 | View Replies]

To: AdmSmith

Interesting increase in troop loses as well as drop in artillery and large increase in AFVs


12,031 posted on 02/16/2025 4:47:44 AM PST by blitz128
[ Post Reply | Private Reply | To 12027 | View Replies]

To: blitz128; PIF; FtrPilot; BeauBo; gleeaikin; Monterrosa-24
🍈 : "Trump agreed with Putin that NATO expansion is at the heart of the war"

Trump & team have said a lot of nice things to get Putin to the negotiating table.
Time will tell which words mattered and which were irrelevant.

blitz128: "NATO expansion is the reason for Putin’s invasion, he knew his pathetic military could never challenge NATO.
If Ukraine joined NATO his dreams of an expanded Russia were over."

Sure, "NATO expansion" and "de-Nazification" are the excuses Putin's propaganda machine published.
But in reality, nothing in regard to either had changed in 2021 or early 2022.

What changed was Putin's perceptions of Western weakness, especially after Biden's disastrous withdrawal from Afghanistan.
Putin saw that as his opportunity to make his moves into Ukraine.

The real reasons for Putin's 2022 invasions are the same as his 2014 invasion and previous invasions of Georgia and elsewhere.
They include:

  1. April 25, 2005, Putin's annual state of the nation address: "'First and foremost it is worth acknowledging that the demise of the Soviet Union was the greatest geopolitical catastrophe of the century,' Putin said.
    'As for the Russian people, it became a genuine tragedy.
    Tens of millions of our fellow citizens and countrymen found themselves beyond the fringes of Russian territory.
    The epidemic of collapse has spilled over to Russia itself,' he said, referring to separatist movements such as those in Chechnya."
    .

  2. Revanchist claims on historical Russian territories such as "Novorossiya".

  3. Personal revenge against Ukraine Pres. Zelensky for:

      "Kremlin reporter Ilya Zhegulev wrote that loyal Putin ally Viktor Medvedchuk is at the center of the Russian leader's so-called "special military operation" in the neighboring country, and that he had already decided to attack Kyiv in February-March 2021.

      2017 Putin & Medvedchuk:

      Medvedchuk is a pro-Kremlin Ukrainian oligarch who was released by Kyiv in a prisoner swap with Russia in September 2022.
      The 68-year-old has close ties with Putin, who is believed to be the godfather of his youngest daughter.
      Medvedchuk was the former leader of a pro-Russian opposition party in Ukraine, and was detained in April 2022 by Ukraine's state security service, the SBU, after he fled house arrest while awaiting trial on treason charges.
      Kyiv has stripped him of his Ukrainian citizenship."

      "In 2021, Ukrainian President Volodymyr Zelensky signed a decree sanctioning three television stations affiliated with Medvedchuk, stopping them from broadcasting.
      For Putin, this was "the final straw," Verstka wrote...
      ...Three sources close to Putin confirmed that these developments were the final straw in Putin's decision to prepare to launch a full-scale invasion of Ukraine.
      "The Kremlin decided not to resort to the tools of 'soft power' anymore
      ."

  4. "Russkiy Mir" semi-religious ideology promoted by "Putin's Brain" Alexander Dugin, Russian Orthodox Patriarch Kirill, Putin himself and his mini-me Medvedev.

  5. Restoring the old Tsarist/Soviet Empires while building a new Axis of Evil Dictators to oppose Western-style democracies:
Bottom line: NATO and "deNazification" were Putin's propaganda excuses, not the real reasons.

12,032 posted on 02/16/2025 6:10:30 AM PST by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 11985 | View Replies]

To: BroJoeK; blitz128; PIF
🍈

This is what YOUR USAID was about to fund, and this is what President Trump cut.


12,033 posted on 02/16/2025 6:28:56 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12032 | View Replies]

To: BroJoeK

Coyote your ability to miss read the room is as big as Putin’s ego.
Super genius lol


12,034 posted on 02/16/2025 6:34:14 AM PST by blitz128
[ Post Reply | Private Reply | To 12032 | View Replies]

To: blitz128
Dimwit, your effort to find humor in first melons and now in calling me coyote is a prime example of why there are no Ukranian comedians.


12,035 posted on 02/16/2025 6:43:15 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12033 | View Replies]

To: BroJoeK
Hey Bro, want a laugh? Can you image these two turning up the heat on The Putin?


12,036 posted on 02/16/2025 6:49:04 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12032 | View Replies]

To: BroJoeK
‼️Attention, China!

Russian propagandists are visibly changing their talking points. Now, they’re calling China not an ally, but practically accusing it of betrayal.

"China is selling drones to Ukraine that kill our soldiers! The Chinese are blocking our payments!"

https://x.com/Gerashchenko_en/status/1891101193402826788


12,037 posted on 02/16/2025 7:30:15 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12032 | View Replies]

To: PIF; FtrPilot; BeauBo; gleeaikin; blitz128; Monterrosa-24

Mini-me Medvedev:

🍈 quoting: "KREMLIN TO ZELENSKY: YOU ARE A CLOWN TO INSULT TRUMP - BITING THE HAND THAT FEEDS YOU"

pic.twitter.com/QCn9RrfWUx— Mario Nawfal (@MarioNawfal) February 15, 2025"

Mario Nawfal is Arab-Australian living in Dubai.

Mini-me Medvedev is a Putin puppet spouting the worst of Russian propaganda.

Mini-me Medvedev with Obama and map of Russia's goals in Ukraine:

The answer is: Trump will ignore Russian propagandists and discuss his concerns with Zelensky directly.
Zelensky may or may not agree to Trump's terms.
My guess is, it won't matter.

12,038 posted on 02/16/2025 7:31:42 AM PST by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 11992 | View Replies]

To: PIF
Russians use tree branches as improvised defense against drones.

https://x.com/bayraktar_1love/status/1891061846758531206


12,039 posted on 02/16/2025 7:36:02 AM PST by FtrPilot
[ Post Reply | Private Reply | To 12037 | View Replies]

To: BroJoeK

Hey Bro, here's some Chay

Von der Leyen and EU "to play no part in Trump-Putin Ukraine talks"

Kellogg quoted by WSJ pic.twitter.com/syrypwtiDZ— Chay Bowes (@BowesChay) February 16, 2025


12,040 posted on 02/16/2025 9:24:04 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 12038 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 12,001-12,02012,021-12,04012,041-12,060 ... 22,081-22,088 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson