Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 11,941-11,96011,961-11,98011,981-12,000 ... 22,061-22,079 next last
To: blitz128

Haha I “new” you couldn’t resist😂


11,961 posted on 02/14/2025 4:03:02 PM PST by blitz128
[ Post Reply | Private Reply | To 11958 | View Replies]

To: AdmSmith

11,962 posted on 02/14/2025 4:43:20 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11806 | View Replies]

To: blitz128
I “new” you couldn’t resist

There is absolutely no need for you to intentionally sprinkle your comment with bonehead mistakes. They're there for the picking.

11,963 posted on 02/14/2025 4:46:48 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11961 | View Replies]

To: blitz128

Gonna have to change you from 🍈 to comrade coyote , ya know “super genius”😎🦆


11,964 posted on 02/14/2025 5:59:32 PM PST by blitz128
[ Post Reply | Private Reply | To 11961 | View Replies]

To: gleeaikin
Russian Offensive Campaign Assessment, February 14, 2025

The Kremlin reportedly ordered Russian government-linked media to reduce reporting about US President Donald Trump and portray Russian President Vladimir Putin as a strong and decisive leader after the February 12 Trump-Putin phone call. Russian opposition news outlet Meduza reported on February 14 that the Kremlin instructed Russian state-run and pro-government media outlets to frame Trump and Putin's February 12 call as Putin's “initiative and victory” and to use Trump's name less frequently in coverage of the call and other events.[7] Meduza reported that the Kremlin is concerned that the Russian public might see Trump as a more “proactive and decisive” leader than Putin and wants Russian media to emphasize that Putin alone is responsible for the outcome of negotiations between him and Trump. An unnamed political strategist in the Russian Presidential Administration told Meduza that the Kremlin does not want the Russian public to perceive Trump as a “strong leader capable of changing the situation” and Putin as a passive or weak leader in comparison. The political strategist added that the Kremlin also instructed the Russian media to manage the public's expectations about negotiations to not create “false, overly optimistic expectations.” The Russian information space has previously portrayed Trump as a pragmatic leader with whom Russia could work, but the Kremlin may be attempting to negatively shift the Russian public's perception of Trump in order to emphasize Putin's strength and agency amid reports of possible future peace negotiations and bilateral negotiations.

Russia is reportedly intensifying efforts to coerce Russian mobilized and conscripted personnel into signing contracts with the Russian Ministry of Defense (MoD). Russian State Duma Deputy Maxim Ivanov told Yekaterinburg-based Russian news outlet EANews on February 7 that his constituents in Sverdlovsk Oblast notified him that Russian military commanders are forcing mobilized Sverdlovsk Oblast personnel to sign long-term military service contracts with the Russian MoD that would classify them as professional contract servicemembers (kontraktniki).[73] Ivanov claimed that Russian military commanders want to increase the number of kontraktniki in their units but noted that commanders are sending any mobilized personnel serving in specialist roles, including artillery, communications, engineering support, and electronic warfare (EW) who refuse to sign a long-term contract to fight in infantry assault units. Ivanov stated that he appealed directly to Russian Defense Minister Andrei Belousov about this issue.

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-february-14-2025

11,965 posted on 02/15/2025 2:57:44 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11887 | View Replies]

1,180 i.e. more than 49 Russians and Norks/h. Vehicles and fuel tanks more than 250% and artillery more than 150% above the average.


11,966 posted on 02/15/2025 3:03:29 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11888 | View Replies]

To: gleeaikin; PIF; blitz128; FtrPilot; BeauBo; USA-FRANCE; canuck_conservative; marcusmaximus; ETCM
Кремлевская табакерка

Suvorov’s ashes were divided into three parts. One of them will be used to inspire the military in the “troubled times of negotiations with the Americans”

Andrey Belousov personally made the decision to divide the remains of the great commander Alexander Suvorov, which were recently returned to the front to hold prayers and meetings of officers near them. Patriarch Kirill advised him to do this. “One part is constantly in the Kursk region, it is difficult there. We believe that Alexander Vasilyevich will help to liberate our lands. The other part is taken to oil refineries and military facilities to protect them from enemy attacks,” a source in the Ministry of Defense told us.

The third part of Suvorov’s ashes will be taken along the entire front line to inspire specially selected officers. They will gather near the remains of Alexander Vasilyevich, pray and reflect on the Victory in the SVO. Afterwards, these officers will have to boost the morale of other military personnel. “Right now, to be honest, troubled times have begun. There are some negotiations with the Americans , they are saying something all the time. In Munich, Washington, Moscow, Kiev. More and more military people are listening to this and starting to think: it will all be over soon, hurray! And they are starting to fight worse. Of course, most of the guys are doing everything well. But there are too many negative signals. Somewhere the fighters did not do their job, somewhere they were too cautious, somewhere they do not want to sign a contract. And so on. Something needs to be done about this,” another source in the ministry explained. And he added: “An effective military man should not think about peace, but about Victory. And the officers who gather near the ashes of Alexander Vasilyevich will be inspired, he will help them. And they will bring this understanding about Victory to other military men who doubt it. Where else can we talk about Victory if not near Alexander Vasilyevich?” More active prayers near the ashes of Suvorov should begin soon. For the sake of safety, “only specially selected and reliable people” will attend them.

https://t.me/kremlin_secrets/5295

Why do today's decision-makers in the Kremlin believe this?
The explanation is that they are continuing the traditions of the Moscovite Russia. In Muscovite Russia, supernaturalism was a fundamental part of daily life.

See Orthodox Russia, Belief and Practice Under the Tsars Edited by Valerie A. Kivelson, and Robert H. Greene
https://www.psupress.org/books/titles/0-271-02349-X.html

This means we should stop calling the country Russia and switch to saying Muscovy.

The Principality of Moscow or Muscovy (1263–1389), later the Grand Principality of Moscow (1389–1547), was a medieval Russian principality. Its capital was the city of Moscow. https://en.wikipedia.org/wiki/Principality_of_Moscow

11,967 posted on 02/15/2025 3:40:50 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11966 | View Replies]

To: AdmSmith

Artillery numbers are crazy high, nope they are accurate


11,968 posted on 02/15/2025 4:22:54 AM PST by blitz128
[ Post Reply | Private Reply | To 11966 | View Replies]

To: AdmSmith

“ commanders are sending any mobilized personnel serving in specialist roles, including artillery, communications, engineering support, and electronic warfare (EW) who refuse to sign a long-term contract to fight in infantry assault unit”

Sounds like something they would so


11,969 posted on 02/15/2025 4:25:42 AM PST by blitz128
[ Post Reply | Private Reply | To 11965 | View Replies]

To: AdmSmith

Hole Blasted By Drone In Chernobyl’s Radiation Shield: What We Know
Ukrainian nuclear experts express concern that the drone strike could have prolonged ramifications to the integrity of the cocoon over the doomed reactor.
https://www.twz.com/news-features/hole-blasted-by-drone-in-chernobyls-radiation-shield-what-we-know


11,970 posted on 02/15/2025 4:44:20 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11967 | View Replies]

To: FtrPilot

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Insane 16-Hour Battle With North Koreans ]

Today [ Feb 14, 8 pm ], there are important updates from the Kursk direction.

Here, in a desperate bid to regain the initiative, Russian forces prematurely pulled North Korean troops from recuperation in the rear and launched them into a grueling 16-hour multi-wave assault to break Ukrainian resolve.

However, this quickly turned into a catastrophe as Ukrainian forces dismantled the assault, leaving the Russian and North Korean forces even more battered than before.

The Russian objective was to launch a massive assault in the western part of the Kursk salient, to disrupt Ukrainian counterattacks in the east, and prevent them from consolidating their newfound gains and advancing further. By keeping Ukrainian forces engaged in the western part of the salient, Russia hoped to stretch Ukrainian defenses thin and set the stage for a deeper offensive beyond the Malaya Loknya River.

The Russian attack began at midnight, taking advantage of darkness to move forces undetected into position. Russian and North Korean troops assembled in the Novoivanovka-Leonidovo agglomeration and the surrounding forests, using the tree cover to accumulate forces before launching their attack.

At first, as the darkness helped the Russians cross the initial stretch of terrain with relative safety, they used various armored vehicles, spearheading the assault and transporting infantry toward Ukrainian positions. They aimed to conduct a relentless push through the open terrain, using sheer numbers to overwhelm the defenders.

However, while the nighttime provided an initial advantage, the Russians faced significant disadvantages that doomed their assault. North Korean troops, already exhausted from previous battles, were pulled from their recovery in the rear, and had no time to rest before being thrown into combat again. Russian forces, too, had been on an operational pause to recover from losses, meaning their reorganization was incomplete, further weakening the assault.

But the greatest obstacle lays in the terrain itself. After crossing the initial 2-kilometer stretch along an already thin, single tree line, the last kilometer toward Nikolsky was open ground, providing no cover from Ukrainian fire.

Ukrainian forces had anticipated a Russian push in this direction and had spent days preparing their defenses, preparing hidden firing positions, and stockpiling supplies. Constant drone surveillance allowed Ukrainian artillery to adjust its fire well before the assault began.

Combat footage from the area reveals the brutal efficiency of Ukrainian defenses. At night, Russian and North Korean forces attempted an infiltration assault, moving in small groups under the cover of darkness. However, thermal imaging exposed them instantly, and precision artillery strikes wiped out entire squads before they could get close.

Then, at daylight, the Russian mechanized column pushed forward, hoping to break through the Ukrainian kill zones. As the first enemy wave emerged from the tree line, FPV drones struck the leading vehicles, forcing the troops to dismount into a kill zone. With no cover and frozen ground preventing them from digging in, the enemy soldiers were left completely exposed.

As more waves followed, Ukrainian defenders unleashed a devastating combination of firepower. Bradley infantry fighting vehicles provided suppressive fire, shredding enemy infantry with their 25-millimeter autocannons. Artillery rained down cluster munitions, causing chaos and further splitting Russian formations.

Drone operators used drone-dropped grenades to eliminate infantry seeking cover in the sparse tree line. The battlefield quickly turned into a massacre, with Russian and North Korean soldiers cut down before they could even reach Ukrainian positions.

In one particularly harrowing clip, North Korean soldiers, wearing inadequate camouflage, are seen trying to shoot down FPV drones with their rifles unsuccessfully, as each drone reaches its target, detonating with pinpoint accuracy. The battlefield is soon covered with the bodies of fallen soldiers, captured by Ukrainian reconnaissance drones hovering above.

Overall, despite deploying North Korean reinforcements in trying to divert Ukrainian attention, the Russians achieved nothing except more staggering losses. The Ukrainian preparations paid off, allowing them to resupply ammunition and drone batteries to continuously eliminate the assaulting groups.

By the end of the 16-hour assault, over a full Russian-North Korean company, over 150 soldiers, had been wiped out. The Russian hope of overwhelming the Ukrainians and securing Nikolsky crumbled in the face of the well-prepared defensive positions. This failure further drained Russia’s already depleted reserves, while Ukrainians remained firmly in control, dictating the tempo of the battle.


11,971 posted on 02/15/2025 4:45:22 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11942 | View Replies]

To: PIF

Not the radiation shield, only the outer roof that protects against rain and bird droppings.


11,972 posted on 02/15/2025 4:51:39 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11970 | View Replies]

Details https://www.world-nuclear-news.org/articles/chernobyl-protective-shelter-damaged-by-drone


11,973 posted on 02/15/2025 5:00:24 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11972 | View Replies]

To: PIF; blitz128; BeauBo
🍈

Good morning Ukrainiacs, how does it feel to be a willing part of a false media narrative paid for by the now defunct and very corrupt USAID?


11,974 posted on 02/15/2025 6:28:02 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11971 | View Replies]

To: BeauBo

Hey bobo, where have you been? are you walking away from this Ukraine debacle?


11,975 posted on 02/15/2025 6:30:31 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11930 | View Replies]

To: PIF; FtrPilot; BeauBo; gleeaikin; blitz128; Monterrosa-24
🍈 again quoting South Africa's Zamaswazi Zinhle Majozi on the UK: Even if we include the 13 American colonies, the maximum British empire was 14.6 million square miles, or 25% of the globe's land area of 57 million square miles.
Yes, you can say: what about habitable land area?
That is ~25 million square miles, however, much of the British Empire was uninhabitable -- including Australia's deserts, Africa's deserts & jungles, India's Himalayan Mountains and Canada's mountains & arctic regions.
So, 25% is the correct number, not 80%.

British Empire at max, circa 1900, covered 25% of Earth's land area.

As for apologies, former colonies which follow British laws and traditions have done amazingly better than others who reverted to pre-civilized behaviors.
The Economist ranks South Africa as a "Flawed Democracy" similar to India, Poland, Hungary and Brazil.

And among those countries "invaded" by Britain: the list includes the USA, who is now Britain's closest of allies.
Other recent enemies who are now very close allies include Napoleonic France, Kaiser's Germany, Fascist Italy and Imperial Japan.
A wise man once said, "countries don't have permanent friends or enemies, only permanent interests."

So, Zamaswazi Zinhle Majozi's real problem is that, like her patron, former S.A. Pres. Jacob Zuma (2009-2018), she prefers the ancient & corrupt Stalinist, communist, fascist, national socialist model of government to the more civilized one the Brits left in South Africa and elsewhere.
Zuma advocates confiscation of white properties without compensation or even due process.

Since Apartheid's end in 1994, South Africa's white population has declined from 5.2 million to now 4.5 million, out of 62 million total population.
It is claimed that some 40,000 white South Africans own 80% of SA's farmland.
Those numbers are certainly exaggerated, but I can't find any more accurate.

Zuma led South Africa to join BRICS in 2010:

11,976 posted on 02/15/2025 6:39:45 AM PST by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 11905 | View Replies]

To: blitz128

Coyote, narrative not false, Putin’s invasion of Ukraine is fact


11,977 posted on 02/15/2025 7:22:05 AM PST by blitz128
[ Post Reply | Private Reply | To 11964 | View Replies]

To: blitz128

False narratives are xiden was aware, Warren is an Indian, soros is philanthropist, USAID was doing good work, demonrats care about wisely using taxpayer dollars, Trump is destroying democracy, and putin invaded Ukraine because of nazis and NATO, not his ego and desire for greater Russia.


11,978 posted on 02/15/2025 7:27:04 AM PST by blitz128
[ Post Reply | Private Reply | To 11977 | View Replies]

To: BroJoeK; blitz128
🍈

These are the three leftist Clowns you Ukranianiacs sent against Putin.

Is it any wonder NATO lost?


11,979 posted on 02/15/2025 7:28:53 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11976 | View Replies]

To: PIF
"But even that person is just a figurehead and PR guy, because the country is actually ruled by the Presidential Administration, currently headed by Andri Yermak, a Russian sympathizer with many connections to the FSB/KGB..."

My understanding is that Zelensky & Yermak are close personal friends going back many years.
So, I'd doubt if Zelensky is Yermak's puppet or if Yermak is as compromised as those allegations might suggest.

11,980 posted on 02/15/2025 7:33:16 AM PST by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 11922 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 11,941-11,96011,961-11,98011,981-12,000 ... 22,061-22,079 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson