Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 11,741-11,76011,761-11,78011,781-11,800 ... 22,101-22,107 next last
To: JonPreston

🍈
Awesome


11,761 posted on 02/11/2025 9:21:08 AM PST by blitz128
[ Post Reply | Private Reply | To 11759 | View Replies]

To: BroJoeK

@RobertKennedyJr is some kind of dangerous conspiracy theorist??

That's because he understands the grossly corrupt Machine they profit from, and he, like his uncle, is dedicated to challenging it. pic.twitter.com/F8qdLw82nd

Chay Bowes

(@BowesChay) February 11, 2025

MAHA


11,762 posted on 02/11/2025 9:26:01 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11760 | View Replies]

To: blitz128
g'afternoon


11,763 posted on 02/11/2025 9:28:10 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11761 | View Replies]

To: All
= 🍈: "Trump demands Ukraine pay back $500 Billion:

Sprinter Observer (@SprinterObserve)"

What Pres. Trump demanded, and received, was a promise of security on American "loans" to Ukraine.
Some of this security is physically located in territory temporarily controlled by Russian military forces.

Trump will not be eager to see his loan securities bargained away in negotiations with Russia.


11,764 posted on 02/11/2025 9:37:31 AM PST by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 11759 | View Replies]

To: BroJoeK; peep; poop; pip

I am sending Secretary of the Treasury Scott Bessent to Ukraine to meet President Zelensky.

This War MUST and WILL END SOON — Too much Death and Destruction.

The U.S. has spent BILLIONS of Dollars Globally, with little to show.

WHEN AMERICA IS STRONG, THE WORLD IS AT PEACE

— Donald J. Trump Posts From His Truth Social (@TrumpDailyPosts) February 11, 2025


11,765 posted on 02/11/2025 9:42:59 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11764 | View Replies]

To: BroJoeK; PIF; AdmSmith; BeauBo; blitz128; marcusmaximus; FtrPilot; SpeedyInTexas; dennisw; ...

Several thoughts: The two humped camels shown here recently are Bactrian Camels, found in the Islamic Stans, and other cold climates well north of Arabian deserts. Siberia is included. Nomadic tribes use them in their wanderings in an out of places with various Islamic governments. Imagine how much more comfortable in a cold climates to ride between two warm humps, rather than on one high hump, safer too.

Even if nothing close to the half $trillion is made available immediately, remember the magic of “high velocity dollars”. A few $million or $billion are disbursed, people are hired and paid, goods are bought for the project(s), people and businesses buy goods they need, and if possible pay taxes. More money is disbursed and continues this process, ad infinitum. Thus spending money makes more money for all concerned, including the US AND UKRAINE.

A map shown a few days ago had a much better display of the rare Earth’s, a fair amount of which is in the area on Ukraine’s east and south east border currently occupied by Russia. I just hope Trump and company remember that Crimea is on top of and surrounded by vast potential gas deposits. Although I imagine the 2 major US oil companies that signed exploration contracts with Ukraine in 2012 will let him forget. THey must have been really pixxed when Putin marched in and forced them to cancel those Crimea area contracts, as well as other oil and gas areas they probably had in those contracts.


11,766 posted on 02/11/2025 11:16:07 AM PST by gleeaikin ( Question authority as you provide links )
[ Post Reply | Private Reply | To 11760 | View Replies]


11,767 posted on 02/11/2025 11:17:52 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11765 | View Replies]

Tucker visited posh European Alps and discovered how Ukrainians are spending US tax dollars

LINK

Tucker Carlson may have cracked the case during his recent trip to the very exclusive European Alps. And what did he find? Well, a whole lot of Ukrainians living the high life. That’s right—the very people we’ve been told are suffering in a war-torn disaster zone are actually sipping champagne in ski lodges, courtesy of the American taxpayer. Tucker puts two and two together, and it’s obvious: your money isn’t funding a war—it’s funding their luxury getaways.

But should we really be surprised? The little guy running the Ukraine racket claims he lost track of $100 billion—like he just misplaced it under a couch cushion or something.

VIDEO: Tucker Carlson Says Ukrainian Military Selling U.S. Weapons to Mexican Cartels, CIA Profiting “It is a fact”

Tucker Carlson has made explosive claims on his show, suggesting that the Ukrainian military is offloading up to half of the military aid it receives from U.S. taxpayers directly to Mexican drug cartels operating along the U.S. border.

In a detailed interview with retired U.S. Army Lieutenant Colonel Daniel Davis, Carlson accused the Ukrainian forces of engaging in a massive black market arms trade.

He went further to say that U.S. intelligence agencies, notably the CIA, are not only aware of this illicit trade but are also profiting from it.

11,768 posted on 02/11/2025 1:30:59 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11767 | View Replies]

To: blitz128
Ukrainian Air Force F-16AM Fighting Falcon returning from a combat air patrol, having expended one of its AIM-120C-series AMRAAM missiles.

Appears to be the first confirmation that Ukrainian Falcons are sporting the more advanced and longer-ranged C-series AMRAAMS.

https://x.com/Osinttechnical/status/1889411650291376487

I sure would like to know what he shot at.

11,769 posted on 02/11/2025 1:46:52 PM PST by FtrPilot
[ Post Reply | Private Reply | To 11761 | View Replies]

To: BeauBo
Donetsk Oblast, a Ukrainian FPV drone hits a Russian T-90M MBT, causing the Russian tank to suffer a catastrophic ammunition cookoff.

https://x.com/Osinttechnical/status/1889380868277350513


11,770 posted on 02/11/2025 1:49:42 PM PST by FtrPilot
[ Post Reply | Private Reply | To 11769 | View Replies]

To: FtrPilot

I sure would like to know what he shot at.

The recently crashed SU-25 maybe?


11,771 posted on 02/11/2025 1:52:03 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11769 | View Replies]

To: gleeaikin
Russian Offensive Campaign Assessment, February 11, 2025

Russian officials are reportedly attempting to constrain Russian milblogger reporting about the current frontline in Kursk Oblast, likely in response to concerns that the West will pressure Russia into trading Russian territory for occupied Ukrainian territory. Several Russian milbloggers who regularly criticize the Russian military's conduct of the war in Ukraine claimed on February 10 and 11 that unspecified actors are calling for Russian authorities to charge the milbloggers with discrediting the Russian military after the milbloggers reported about recent Ukrainian advances southeast of Sudzha.[3] The milbloggers claimed that the Russian military command is targeting them for publishing information about successful Ukrainian attacks near Cherkasskaya Konopelka and Fanaseyevka, and one milblogger claimed that the recent Ukrainian attacks forced the Russian military command to delay plans for a future offensive operation in the area. The latter claim indicates that the Russian military command may have been planning to conduct an offensive operation to seize Sudzha, a prominent gas transit hub and the main town that Ukrainian forces control in Kursk Oblast.

The Russian military appears increasingly anxious to consolidate control over reporting about the situation in Kursk Oblast as Zelensky continues to express his intent to leverage Russian territory in future peace negotiations. Zelensky stated during his interview with The Guardian that he intends to use Ukrainian-held territory in Kursk Oblast to secure the return of Russian-occupied Ukrainian territory or “something else” during future peace negotiations with Russia.[4] Zelensky noted that it is important to retake all of occupied Ukraine and did not speculate on which area of occupied Ukraine he would consider trading Russian territory for. Russian President Vladimir Putin likely intends to expel Ukraine from Kursk Oblast, or at least from Sudzha, before beginning peace negotiations in order to avoid having to trade occupied Ukrainian territory for Russian territory.

The Kremlin may be setting informational conditions for possible false-flag attacks in the Baltic Sea and against Russian opposition politicians living abroad in order to discredit Ukraine. The Russian Foreign Intelligence Service (SVR) claimed on February 11 that Ukraine's Main Military Intelligence Directorate (GUR) with assistance from unspecified Western countries intend to blow up a foreign vessel in the Baltic Sea to prompt NATO to block Russia's access to the Baltic Sea and start a direct armed conflict between Russia and NATO.[16] The SVR claimed that unspecified European intelligence services and Ukraine's GUR also plan to assassinate Russian opposition figures living abroad and blame Russia for the assassinations to undermine future peace negotiations. Russia's SVR has previously accused Ukraine and other Western states of planning false flag attacks to discredit Ukraine and drive a wedge in Western unity behind Ukraine, particularly at critical moments in Western discussions regarding support for Ukraine and a possible peace plan.[17]

Russian regional authorities are reportedly reducing payments due to regional budget deficits for Russian soldiers who received minor injuries. Russian opposition outlet Verstka reported on February 11 that at least 42 Russian federal subjects and occupation authorities in Crimea introduced a reduced payment for Russian soldiers who sustained minor injuries.[74] Russian authorities previously offered a 500,000-ruble ($5,181) payment to all wounded Russian soldiers regardless of the severity of the injury. The Russian federal government published a decree in November 2024 establishing reduced payments for Russian soldiers who receive only minor injuries in battle rather than providing blanket payments to all injured personnel. Verstka noted that some Russian federal subjects, including Kamchatka Krai, changed their injury compensation system to align with the federal system in recent months, while others, including Amur Oblast, already had payment systems similar to the federal government's new system. The Kremlin has recently taken measures to reduce various payments to Russian soldiers, including one-time recruitment bonuses, amid other indicators that the Kremlin is concerned about the long-term costs of the war and ongoing wartime pressures on the Russian economy.[75]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-february-11-2025

11,772 posted on 02/12/2025 1:37:23 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11704 | View Replies]


11,773 posted on 02/12/2025 1:40:05 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11463 | View Replies]


11,774 posted on 02/12/2025 1:41:37 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11773 | View Replies]

1,150 i.e. more than 47 Russians and Norks/h. Vehicles and fuel tanks more than 230% and artillery more than 130% above the average. Increase in tank losses, indicates a likely increase in Russian attacks.


11,775 posted on 02/12/2025 2:19:28 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11705 | View Replies]

To: PIF
Кремлевская табакерка
Officials Want to Ban Talking About the End of the Cold War Soon

Several influential people in the Presidential Administration have come forward with this initiative. One of them explained to us that talk about the imminent end of hostilities is dangerous and “could have unpredictable consequences.”

“Firstly, we all have such high hopes for Trump… Trump is not ours yet. I think he will be, but for now, he says a lot of things incorrectly. Secondly, a number of our officials, especially those who work with the economy, are shouting from almost every corner that the Cold War will end soon. Otherwise, there will be trouble, and we will all die of hunger here. Why do this?” the source was indignant. “Thirdly, many military personnel hear that the Cold War will end soon and begin to do their duty poorly. They think, like, why should we die and risk our lives now? This is also very wrong. And who even said that the Cold War is nearing its end? I don't understand,” he added.

Vladimir Putin is currently considering the initiative. If he approves it, those who “talk too much about the imminent end of the SVO” will be punished for it. At the very least, they will lose their posts. But the sanctions against them may be even more severe.

https://t.me/kremlin_secrets/5281

11,776 posted on 02/12/2025 2:35:50 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11775 | View Replies]

To: BroJoeK
Vlad Vexler: Why Putin Is Scared of Talks With Trump

https://www.youtube.com/watch?v=cMt9ozTCLiM
15 min video, but increase the speed

11,777 posted on 02/12/2025 3:23:20 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11764 | View Replies]

To: AdmSmith

Russian regional authorities are reportedly reducing payments due to regional budget deficits for Russian soldiers who received minor injuries.

“Look troop, just because you lost a hand, others have lost 2 hands, so claim denied. Its just a minor flesh wound.”


11,778 posted on 02/12/2025 4:28:13 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11772 | View Replies]

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ “Straight Out of a Horror Movie!” 1,000+ Russians Lie Dead in Front of a Tiny Village ]

Today [ Feb 11, 8 pm ], there are a lot of interesting updates from the Liman direction.

Here, in a brutal fight for Terny, Russian soldiers were thrown into wave after wave of assaults, only to face relentless Ukrainian firepower.

What followed on the battlefield was described by surviving Russian soldiers as scenes straight out of a horror movie, with the fight for this small village resulting in over 1,000 Russian soldiers being wiped out.

The goal of the Russian forces in this area was to take Terny, which they had failed to achieve for over a year of constant assaults. By taking over the settlement, Russian forces would accomplish the first step in eliminating the Ukrainian bridgehead on the east bank of the Zherebets river, while securing the flank of their bridgehead in the west.

By doing so, Russian forces would only be separated from Liman by several kilometers of open fields. To achieve this, Russian commanders send forth small infantry groups in day-and-night assaults, hoping to overwhelm Ukrainian defenders, who describe the setting as a constant conveyor belt of small Russian assaults.

The main advantage of the Russian forces in this area is their bridgehead in the village of Ivanivka on the western bank of the Zherebets River. These positions enabled the Russian forces to cut off one of the two Ukrainian supply lines to Terny, and place the Ukrainian positions in the village in a cauldron.

On top of that, if we take a look at the topographic map, we can see that the Russians control the high elevations, both to the east and west of Terny. This allows their reconnaissance teams to observe Ukrainian positions and movements in the village, which is located in the lowlands.

However, during the past year of intense assaults, the Russians had lost so many armored personnel carriers and tanks here, that they were forced to use civilian cars and unarmored trucks to deploy their soldiers to the frontline.

Furthermore, Russians continue to have to cross over ten kilometers of open fields to even reach Ukrainian positions.

With Ukrainians conducting extensive drone surveillance, many Russian reinforcements become exposed to Ukrainian fire during their transport to the frontline, resulting in disastrous casualties, even long before they reach Ukrainian positions, and only allowing very small groups to actually launch the planned assaults.

Footage posted by a Russian soldier fighting in the Liman direction shows the aftermath of Ukrainian nightly Vampire drone raids on Russian supply lines, with entire columns of destroyed Russian cars and trucks littering the road.

Additional footage reveals how Russian convicts were sent toward Terny without body armor, helmets, or rifles to draw Ukrainian fire while trying desperately to hide from Ukrainian drones and small arms fire. However, after the convict recruit waves ended, trained Russian soldiers initiated their assault on the detected Ukrainian positions.

Despite showing good skill and aggression, their small numbers could not compensate against real-time intelligence received from Ukrainian drone operators, as the Ukrainian defenders were able to eliminate the Russian soldiers as they charged forward.

Later, one Russian soldier released another video of him walking through a tree line on his way to the front, where the aftermath of the suicidal Russian tactics becomes ever apparent. As he continued walking past the bodies of dozens of Russian soldiers, he expressed the terrible smell on the way to the front while describing the sight as, quote, like a horror movie, showing the immense scale of Russian losses.

Overall, the recent Russian campaign for Terny has resulted in over 1,000 Russian soldiers being killed in grinding battles, all for one small settlement. The Ukrainian 60th Separate Mechanized Brigade has effectively held off the combined efforts of 2 full-strength Russian divisions, outnumbered approximately 5 to 1, not just around Terny, but the whole Zherebets River.

Still, the Ukrainian defenders are managing to deplete the Russian offensive capabilities around Terny and inflict severe losses. This has led the Russians to no longer having the armored units available to support their attacks, only leading to further increased casualties and an even slower rate of advance.

Russian forces will continue to incur high losses, as they have only now entered Terny, with them having to suffer even more to actually take the settlement.


11,779 posted on 02/12/2025 4:32:44 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11778 | View Replies]

To: PIF

"Mr. Vice President, I swear their economy is in TATTERS. They are using washing machine chips to power up their tanks, fighter jets and shovels. Mr. Vice President, you have to believe me." pic.twitter.com/esYuWXXKRa— Alex Christoforou (@AXChristoforou) February 12, 2025

"Mr. Vice President, I swear their economy is in TATTERS. They are using washing machine chips to power up their tanks, fighter jets and shovels. Mr. Vice President, you have to believe me."


11,780 posted on 02/12/2025 4:34:35 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11779 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 11,741-11,76011,761-11,78011,781-11,800 ... 22,101-22,107 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson