Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 11,541-11,56011,561-11,58011,581-11,600 ... 18,861-18,877 next last

🚨🇺🇸TRUMP STRIPS SECURITY CLEARANCES FROM NY AG LETITIA JAMES, ALVIN BRAGG AND OTHER 'DEEP STATE' FIGURES

Trump has revoked security clearances for New York Attorney General Letitia James, Manhattan DA Alvin Bragg, and other top anti-Trump figures, including ex-Secretary of… pic.twitter.com/mWm6KLaltt— Mario Nawfal (@MarioNawfal) February 8, 2025

TRUMP STRIPS SECURITY CLEARANCES FROM NY AG LETITIA JAMES, ALVIN BRAGG AND OTHER 'DEEP STATE' FIGURES

Trump has revoked security clearances for New York Attorney General Letitia James, Manhattan DA Alvin Bragg, and other top anti-Trump figures, including ex-Secretary of State Antony Blinken.

Trump also banned them from federal buildings, calling it a necessary step to protect national security from partisan operatives.

- James and Bragg led high-profile lawfare cases against Trump.

- Blinken orchestrated the infamous Hunter Biden laptop cover-up.

- Other officials targeted include: Biden's ex-National Security Advisor Jake Sullivan, Deputy AG Lisa Monaco, and Trump-Russia hoax figures Andrew Weissmann, Mark Zaid, and Norm Eisen.

Trump previously cut off Biden’s access to classified briefings, saying: "I don’t trust him."

Source: NY Post

11,561 posted on 02/08/2025 3:22:10 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11560 | View Replies]

To: PIF; FtrPilot; AdmSmith

I noticed the Asian looking eyes on the soldier and also thought Nork, and maybe things are so bad in NK, that they work better with animals than with machines.


11,562 posted on 02/09/2025 2:27:27 AM PST by gleeaikin (in Question authority as you provide links )
[ Post Reply | Private Reply | To 11544 | View Replies]

To: blitz128; BeauBo; FtrPilot; PIF
blitz128: "Doesn’t change the fact that dear leader invaded Ukraine."

Exactly right.

blitz128: "Not sure what 🍈’s point is? Posting it here?"

Obviously, to confuse the issue and sap American will to support Ukraine's freedom fighters.
And that worked well in Vietnam, worked again in the War On Terror, so why not in Ukraine?

Such tactics only work when Americans suffer from poor leadership, which, sadly, has been all too often, but which we now seem to have solved, in spades.

Propaganda against American voters works, from Vietnam (1975) to Afghanistan (2021):


11,563 posted on 02/09/2025 3:47:47 AM PST by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 11517 | View Replies]

To: PIF
quoting BJK: "Euros have troops to defend a none-existent threat to Greenland,"

Sorry, my mistake -- to be clearer, I should have added the word "American" before the word "threat".

If the Euros want to help Americans defend Greenland against Russian and Chinese threats, I'm pretty certain arrangements can be made to include them.

But I'd think Europeans would be much more concerned about real threats much closer to their homes, from Russia.

11,564 posted on 02/09/2025 3:56:08 AM PST by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 11525 | View Replies]

To: BroJoeK

🍈 likes to conflate corruption, leftist money laundering….. as justification for Putin’s actions.
President Trump is cleaning that up, and will deal with Putin.

The result will be Ukraine will get more of what it needs to fight Putin effectively and without BS restrictions.

There is no doubt that the former administration used Ukraine to launder money, that is not as much an indictment of Ukraine, but of xiden administration.

Personally I do believe the theory that Ukraine was given enough to bleed Russia and set them back decades both militarily and economically.

What’s done is done sadly, and Ukrainians amd average Russians paid the price, but now is the time to unleash power and pressure on Putin to end this. More importantly to pressure those around Putin to end this one way or the other.

Let the rest of the world(Xi) see this, and understand.


11,565 posted on 02/09/2025 4:07:06 AM PST by blitz128
[ Post Reply | Private Reply | To 11563 | View Replies]

To: blitz128
"There is no doubt that the former administration used Ukraine to launder money, that is not as much an indictment of Ukraine, but of xiden administration."

Actually, beyond Hunter Biden's employment by Burisma Holdings from 2014 to 2019, we don't actually have any details about alleged money laundering.

Yes, considering how corrupt the Biden crime family is, we can well expect to eventually see such details, but, as of today, we have no idea the real scope and extent of Biden administration corruption, graft, kick-backs, money laundering, etc.

Hopefully, all that is rapidly ending.

11,566 posted on 02/09/2025 4:36:05 AM PST by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 11565 | View Replies]

To: blitz128

It is a tragedy and a crime that the US and by extension Ukraine had to suffer through the last 4 years, but it seems we had to, to reach this point

If Trump had won in 2020 his administration would have been mired in deep state BS. Trump would not have had the mandate he now has, and the American people would not have seen just how corrupt its govt had become.

The overt corruption and lawfare, the corrupt media, the politicalization of every institution, and the left exposing its desires through woke policies like DEI, and trans indoctrination may have flown under the radar

The past four years have led to this moment. For some reason 🍈 likes to point out Trump’s successes as if those here would find them bad, I guess in relation to supporting Ukraine against Putin’s war.

Couldn’t be further from the truth. I am ecstatic over what President Trump and his admin strips are doing.


11,567 posted on 02/09/2025 4:36:09 AM PST by blitz128
[ Post Reply | Private Reply | To 11565 | View Replies]

To: gleeaikin
Russian Offensive Campaign Assessment, February 8, 2025

Russia may be providing drone and missile technology to North Korea in exchange for North Korean troops fighting in Kursk Oblast. Japanese outlet NHK, citing multiple sources familiar with Russia–North Korea relations, reported on February 8 that Russia has agreed to assist North Korea in developing and mass-producing various types of drones in exchange for North Korean forces supporting Russia's war effort against Ukraine.[1] NHK noted that Russia remains reluctant to help North Korea develop nuclear weapons, fearing that North Korean nuclear tests could further strain relations with the United States and complicate relations with the People's Republic of China (PRC), however. Ukrainian President Volodymyr Zelensky noted on February 8 that Russia is specifically spreading modern technology to North Korea, including drone technology, and told Reuters on February 7 that thousands of North Korean troops have returned to active combat in Kursk Oblast after a brief pause.[2]

A Ukrainian brigade operating in Kursk Oblast published a video on February 8 reportedly showing North Korean forces conducting assaults alongside Russian forces in Kursk Oblast.[3] South Korean sources recently reported that Russia withdrew North Korean troops from the battlefield in Kursk Oblast in mid-January 2025, possibly for rest and reconstitution or to rethink how Russia is using these troops.[4] ISW assesses that North Korea is using the war in Ukraine as a testing ground for its own military capabilities.[5] Reuters reported on February 6 that North Korean ballistic missiles fired by Russian forces since December 2024 have demonstrated significantly improved accuracy, likely an example of North Korean capability enhancement gained through the North Korea-Russia alliance.[6]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-february-8-2025

11,568 posted on 02/09/2025 4:47:19 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11507 | View Replies]


1,460 i.e. more than 60 Russians and Norks/h. Vehicles and fuel tanks more than 250% above the average + a downed Russian Su-25 attack aircraft near the town of Toretsk in Donetsk Oblast.



11,569 posted on 02/09/2025 4:55:34 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11510 | View Replies]

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Ukrainian Precision Strike Caused Massive Casualties ]

Today [ Feb 08, 8 pm ], there are a lot of interesting updates from Bakhmut’s direction.

Here, in the fiercely contested town of Chasiv Yar, Russian forces launched relentless assaults in a bid to break through the final Ukrainian defensive lines.

But as a concentration of over a 100 Russian soldiers was detected in preparation for a final assault, Ukrainians launched a devastating air strike with bunker-buster munitions, eliminating hundreds of Russian soldiers at once.

The goal of the Russian forces in this area is to take control of Chasiv Yar. A breakthrough in this town will enable the Russians to breach the last major Ukrainian line of defense in front of the much larger town of Kostyantinivka.

To take over Chasiv Yar, the Russian forces are engaging in brutal close-quarters fighting in the central part of the town, where their advance is measured in inches, while suffering severe casualties. Russian forces are deploying squads of infantry stormtroopers in narrow urban areas, combined with artillery and close air support.

The dense urban environment, including the central high-rise building district and the industrial zone of the local refractory plant, heavily determines the style of fighting in the central part of the town. While heavy fighting occurs for the refractory plant, the Ukrainian forces maintain stable control of the central high-rise buildings.

While Russian and Ukrainian forces have drone and air parity in this direction, Ukrainians have demonstrated a greater ability to utilize their resources. The control of the central high-rise buildings, which overlook Russian positions in the industrial zone and residential houses below, allows them to conduct effective reconnaissance and targeting against Russian movement through the town.

Meanwhile, Russian artillery and air support lack the precision of the Ukrainian forces. However, they compensate through the high density of their artillery fire and air strikes, with Russians dropping up to 4 glide bombs on a single position, hoping to hit their target successfully.

Footage released by Ukrainian fighters reveals how the intense Russian shelling and bombing led to the near-complete destruction of the town, where only walls are left from most buildings.

This further worsened the Russian situation because the widespread destruction of infrastructure with inaccurate shelling and air strikes, led to minimal Ukrainian losses, while it also destroyed any cover and concealment that Russian forces needed for advancing, as Russian movements became ever exposed to Ukrainian drone reconnaissance and following precision strikes.

Because of this lack of cover, Ukrainian drone operators discovered that Russian forces were gathering in basements and bunkers around Kalynivka, from where they advanced into northern Chasiv Yar and towards the refractory plant.

In response, Ukrainians intensified their surveillance of the area and soon spotted a group of Russian soldiers moving through the abandoned pipelines and into the basement of the water treatment facility.

As Ukrainians waited to see what the Russians would do, they quickly counted over a 100 Russian soldiers gathered in the basement below the building. It became clear that the Russians were preparing a final, all-out assault to overwhelm Ukrainian defenders in the central district.

With such an assault being able to turn the tide of the battle, Ukrainians called in the Air Force to launch a bunker buster JDAM bomb on the building.

As the footage shows, the bomb effectively breached and penetrated deep into the ground, destroying the Russian underground bunker and killing all Russian soldiers inside. To hide their losses and make room for new soldiers to gather in the facility’s basement to continue their assaults, Russian commanders ordered the bodies to be burnt, causing a sickening smell to spread over the town.

In the end, Russians planned to gather a large group of soldiers to launch a final overwhelming assault on Ukrainian positions, which Ukrainian drone operators quickly detected. To eliminate this threat, Ukrainians launched a devastating airstrike that killed over a 100 Russian soldiers.

The suddenness and severity of these losses have also severely devastated Russian morale and offensive efforts in the town as Russians struggle to push forward.

The Russian command will likely have to pause their operations in Chasiv Yar to find new accumulation points in the rear for their soldiers to prevent the Ukrainian forces from continuing their deadly precision strikes.


11,570 posted on 02/09/2025 4:58:24 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11568 | View Replies]

To: BroJoeK

Yes I hope we find out, and by the reaction of the left and media it has certainly begun. The level of corruption exposed, however, is just the tip of the iceberg

My belief is those that benefited most from the corruption/ money laundering were not the Ukrainians, but corrupt officials and entities here in the US.


11,571 posted on 02/09/2025 5:20:42 AM PST by blitz128
[ Post Reply | Private Reply | To 11566 | View Replies]

To: blitz128; BroJoeK
🍈 likes to conflate corruption, leftist money laundering….. as justification for Putin’s actions.

Alfred, until you trace the start of this war back to (at least) the USAID financed Maidan Color Revolution of 2014 (Google Cookies Nuland) you will remain dazed and confused


11,572 posted on 02/09/2025 5:28:42 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11565 | View Replies]

To: BroJoeK; blitz128
Actually, beyond Hunter Biden's employment by Burisma Holdings from 2014 to 2019, we don't actually have any details about alleged money laundering.

Start here with Zelensky's own words, BroJoeK.

Hope this helps you both.


11,573 posted on 02/09/2025 5:35:19 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11566 | View Replies]

To: blitz128

🍈 until you realize that regardless whether it was a “coup “ or funding support of the people to remove a corrupted govt/president(he fled where?), putin illegally invaded a sovereign country..

You continue to ignore that the govt had reneged on its promises to move towards the west and away from russia(putin never interfered in other countries businesses 😎), and continue to claim putin had the right to invade, murder, destroy to “save “ Ukraine…..

Well I guess you will have to keep firing broadsides of memes


11,574 posted on 02/09/2025 5:43:47 AM PST by blitz128
[ Post Reply | Private Reply | To 11571 | View Replies]

To: BroJoeK

🍈 doesn’t seem to grasp that we agree on the corruption, and Trump is fixing that.

🍈makes me 😂


11,575 posted on 02/09/2025 5:45:48 AM PST by blitz128
[ Post Reply | Private Reply | To 11566 | View Replies]

To: blitz128
🍈 until you realize that regardless whether it was a “coup “ or funding support of the people to remove a corrupted govt/president(he fled where?), putin illegally invaded a sovereign country..

Alfred, their border war isn't the business of insolvent American taxpayers, except in the minds of a handful of foreign policy Interventionists such as yourself and what remains of the Democrat Party.

MAGA is now properly focused on OUR BORDER INVASION, as it should be.

Please read and learn

US foreign aid transformed Ukraine. Its suspension threatens decades of work

With the stroke of a pen, U.S. President Donald Trump last week put a freeze on projects that have helped Ukraine become freer and more democratic since the earliest days of its independence in 1991.

The White House ordered a 90-day suspension of U.S. foreign aid-funded projects globally, to ascertain if they aligned with "American interests" and "American values."

The agencies affected include the National Endowment for Democracy, the Food for Peace Emergency Program, and the U.S. Agency for International Development (USAID), an organization particularly active in Ukraine.

Since the start of Russia's full-scale invasion, USAID has provided Ukraine with $2.6 billion in humanitarian aid, $5 billion in development assistance, and more than $30 billion in direct budget support, helping to rebuild schools after Russian attacks, pay for bomb shelters, advanced medical equipment for hospitals and much more.

Yet USAID's support for Ukraine began well before the full-scale invasion and, according to people who have worked on such projects, their work is vital, and their value immeasurable.

11,576 posted on 02/09/2025 5:53:58 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11574 | View Replies]

God bless The Trump.

Joe Biden never once picked up the phone in an effort to bring peace to the region

One day you Biden foreign policy supporters are going have to explain to us why you supported his Ukraine effort

🚨🇺🇸🇷🇺TRUMP: I'VE SPOKEN TO PUTIN ABOUT ENDING THE WAR IN UKRAINE

Trump revealed the talks about ending the war in Ukraine, saying Putin "wants to see people stop dying."

When pressed on how many times they’ve talked, Trump responded, "Better not say."

He also confirmed plans… pic.twitter.com/tZYzOacRja— Mario Nawfal (@MarioNawfal) February 9, 2025

Trump revealed the talks about ending the war in Ukraine, saying Putin "wants to see people stop dying."

When pressed on how many times they’ve talked, Trump responded, "Better not say."

He also confirmed plans to meet Zelensky next week to discuss a resolution.

With the war nearing its third anniversary and thousands dead, Trump insists he has a concrete plan to end it but isn’t sharing details yet.

Source: Reuters

11,577 posted on 02/09/2025 6:06:21 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11576 | View Replies]

To: blitz128
or funding support of the people to remove a corrupted govt/president

Alfred, do you realize you are describing the USAID model of "regime change"?

11,578 posted on 02/09/2025 6:09:25 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11574 | View Replies]

To: blitz128
Welcome to the 19th century, that is, to today's Russia:

It's the 21st century, and in Chuvashia, patients in the outback are transported to the ambulance in winter on drags, and in summer - on garden wheelbarrows. The latest such incident occurred the day before. A team of doctors who arrived at the call in the village of Golov in the Krasnoarmeysky District simply did not risk driving on a bridge over a ravine that did not inspire confidence.

https://www.youtube.com/watch?v=X6_WG0YJmu8

PS: He died in the hospital according to https://idel-ural.org/archives/chynovnyky-v-chuvashyy-nazvaly-neeffektyvnym-stroytelstvo-dorog-v-malonaselennye-punkty/

11,579 posted on 02/09/2025 6:14:26 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11575 | View Replies]

To: AdmSmith
An overview of recently destroyed Russian and DPRK equipment and personnel in the Kursk region, inflicted by the 1st Assault Battalion of the 92nd Assault Brigade.

https://x.com/NOELreports/status/1888571027342385183


11,580 posted on 02/09/2025 6:31:56 AM PST by FtrPilot
[ Post Reply | Private Reply | To 11579 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 11,541-11,56011,561-11,58011,581-11,600 ... 18,861-18,877 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson