Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 11,461-11,48011,481-11,50011,501-11,520 ... 22,121-22,134 next last
To: BroJoeK
"NATO must win or we will lose!" - General Billingsworth

NATO Weighs Troop Deployment to Greenland Amidst US Tensions

NATO countries, including Germany, have engaged in informal discussions about deploying troops to Greenland in response to statements by US President Donald Trump regarding the potential use of military force to seize control of the Danish island. These talks reflect the geopolitical tensions and strategic importance of Greenland due to its rich mineral resources and military significance.

JUST IN - Germany and other NATO countries discuss "sending troops" to Greenland in response to Trump's remarks — Telegraph— Disclose.tv (@disclosetv) February 7, 2025


11,481 posted on 02/07/2025 7:41:36 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11478 | View Replies]

To: blitz128
🍈, Putin should have not started this war

Such a Dimwit

When They Blame Putin for Starting the War, Show Them This

Ukraine Was Not in NATO, but NATO Was in Ukraine Since 2014



The Alliance Began Training the Ukrainian Military in 2014 Averaging 10 000 Trained Troops Annualy

The US & its Allies Were Effectively Turning Ukraine…

pic.twitter.com/vq8o0s2i1S— Ignorance, the root and stem of all evil (@ivan_8848) February 7, 2025


11,482 posted on 02/07/2025 7:50:04 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11470 | View Replies]

To: gleeaikin
gleeaikin: "Does (could) the fact that much of what we send Ukraine lands in Poland before it is forwarded to Ukraine have any influence on Ukraine’s perception of how much it actually has received from us?"

Yes, but that's only one aspect of it.
So, numbers we see are all over the map, however, US aid to Ukraine falls under three general categories:

  1. Military hardware -- circa $75 billion Pres. Zelensky acknowledges receiving.

  2. Humanitarian aid -- circa $30 billion directly to Ukrainians and refugees in other countries, that Zelensky may never see.

  3. Financial aid -- circa $100 billion including aid to Ukraine's government, but also money for military training and exercises outside Ukraine.
When Americans talk of Ukraine aid, we mean the total it costs us.
I think Zelensky is only looking at the hardware he actually received.
How much corruption, if any, is involved in all this is impossible to say today.
We do know the Biden administration claimed there was none, zero.
In due time, perhaps D.O.G.E. will tell us something different.

gleeaikin: "It is interesting how much this war resembles what happened with the Spanish Civil War in the second half of the 1930s. "

The Spanish Civil War (1936-1939) is a good analogy.
Others I like are:

Hitler's invasions of:

  1. the Rhineland (1936),
  2. Austria (1938) and
  3. Czechoslovakia (1939 )
Mussolini's invasions of:
  1. Ethiopia (1934) and
  2. Albania (1939)
Plus, the Japanese invasions of:
  1. China (1931)
  2. Indochina (1940)
All of these came during a time when no Western power was willing to stand up against aggressor nations.
11,483 posted on 02/07/2025 7:59:04 AM PST by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 11473 | View Replies]

To: BroJoeK

11,484 posted on 02/07/2025 8:15:50 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11483 | View Replies]

To: gleeaikin; BroJoeK; AdmSmith; BeauBo; FtrPilot; SpeedyInTexas; PIF; blitz128; marcusmaximus; ...
Does (could) the fact that much of what we send Ukraine lands in Poland before it is forwarded to Ukraine have any influence on Ukraine’s perception of how much it actually has received from us?

It's more likely that we sent all this money and material to the most corrupt country in Europe without an audit and now with Trump in office, Zelensky is trying to get ahead of DOGE and the boyz.

11,485 posted on 02/07/2025 8:21:30 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11473 | View Replies]

To: PIF
On Feb 3, Ukrainian forces struck the occupied city of Selidove. Reports indicate that all commanders of Russia’s 35th Motorized Rifle Brigade, operating in the Pokrovsk direction, were eliminated.

https://x.com/NOELreports/status/1887939672585687221

Selidove on Google Maps


11,486 posted on 02/07/2025 11:10:18 AM PST by FtrPilot
[ Post Reply | Private Reply | To 11480 | View Replies]

To: FtrPilot
As Ukraine struggles to field soldiers, recruitment centers are attacked

As Ukraine struggles to field soldiers, recruitment centers are attacked

KIEV — As Ukraine faces a desperate shortage of troops at the front line, there has been a wave of bombings against the recruitment centers meant to replenish the ranks, which law enforcement officials are calling a Russian-orchestrated campaign.

In just the past week, explosions have gone off at three draft offices across the country. In two of the blasts, those placing the bombs were also killed, while 12 others were injured, including servicemen. Ukraine’s domestic security service, the SBU, said that Russian special services are recruiting young men to carry out the attacks in exchange for money.

11,487 posted on 02/07/2025 11:43:58 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11486 | View Replies]

To: FtrPilot
Russians complain about plastic explosives planted in their FPV goggles.

https://bsky.app/profile/specialkhersoncat.bsky.social/post/3lhloxwtwvk2t

https://t.me/ssternenko/39706

11,488 posted on 02/07/2025 12:50:48 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11486 | View Replies]

In the last couple of days, there have been numerous videos/photos appearing of Russian soldiers who have donkeys at their disposal. According to Russian sources, they have begun to be given to some units as pack animals.

https://bsky.app/profile/specialkhersoncat.bsky.social/post/3lhhqtbcmts2r

more pictures from the original sourcehttps://t.me/mag_vodogray/11816


Extra picture


11,489 posted on 02/07/2025 1:11:01 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11488 | View Replies]

To: AdmSmith
Ukraine offers the U.S. a partnership in resource development, not just transfers, Zelensky told Reuters.

https://x.com/NOELreports/status/1887946918699135385

Art of the Deal.

11,490 posted on 02/07/2025 1:28:53 PM PST by FtrPilot
[ Post Reply | Private Reply | To 11489 | View Replies]

To: PIF
Trump announced plans to meet with Zelensky next week. He -once again- spoke about the sheer numbers of dead and wounded and stated that it would have never happened it he was President. Trump also said they aim securing Ukrainian rare metals.

https://x.com/NOELreports/status/1887941051392082362

FTA: ...Trump also said they aim securing Ukrainian rare metals.

11,491 posted on 02/07/2025 1:31:47 PM PST by FtrPilot
[ Post Reply | Private Reply | To 11490 | View Replies]

To: BeauBo
A historic event will take place later this week: on 8 February, the Baltic states will officially leave the Russian-fed power grid and will synchronize with the grid of Continental Europe.

Congratulations to the great geostrategist Putin.

The Baltic states were integrated into the Russian-led Integrated Power System back in the Soviet times. The decision to leave the Russian-led system and fully integrate into the European system was made back in 2018, but its execution was sped up after the Russian full-scale invasion into Ukraine and Russian weaponization of energy.

This is an important step as Russia remains a threat to the EU and is prone to energy blackmail. By the way, back in March 2022, Ukraine and Moldova also completed this process in less than three weeks (and being part of the European power grid has helped Ukraine a lot after Russia's massive attacks on our energy infrastructure).

Also, this will put Russia's Kaliningrad (formerly known as Königsberg) into "island mode" - its power grid will be without an external connection. According to experts, Kaliningrad has all the necessary resources for its grid to function.

However, Russia has already applied various tactics to disrupt the Baltics' transition, including cyberattacks and disinformation campaigns.

In response and after recent cable damages in the seas, Lithuania and Poland have enhanced the protection of the cross-border LitPol Link cable and increased their cybersecurity measures.

https://x.com/Gerashchenko_en/status/1887819767064481811


11,492 posted on 02/07/2025 1:42:30 PM PST by FtrPilot
[ Post Reply | Private Reply | To 11491 | View Replies]

To: FtrPilot

Note: transcript differs from the printed script in a few minor ways

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Ukrainian Strikes Wipe Out Massive Russian Columns ]

Today [ Feb 07, 8 pm ], there are a lot of interesting updates from the Velyka Novosilka direction.

Here, a massive Russian offensive was set into motion, aiming to consolidate control over the town and break through the Ukrainian defenses.

However as it turned out, Ukrainians positioned strategically on higher ground had turned the settlement into a massive fire pocket, eliminating all the Russian columns moving into the town, with overwhelming artillery fire, hunted down the Russian assaults from their positions on the high ground with deadly precision.

The main goal of the Ukrainian forces in this area is to target and eliminate Russian forces trying to enter and consolidate control of Velyka Novosilka. The Russians are trying to exploit their control over the town’s large infrastructure to achieve numerical superiority, by accumulating large forces for an offensive effort to the north.

Consolidating their control of the town would also allow them to establish stable logistics by using the infrastructure to set up ammo depots, tank repair workshops, and field hospitals for wounded soldiers, further supporting their offensive.

To prevent this, Ukrainian fighters conduct constant aerial drone reconnaissance and utilize their positions north of the town, to target large Russian columns that are trying to enter Velyka Novosilka.

The main advantage of the Ukrainian forces is the location of their positions to the north of the town - the Ukrainian positions are located at a higher elevation than the Russian-held Velyka Novosilka. If we look at the topographic map, we can see that the Russians have inherited the disadvantageous positions in the lowlands that allowed them to take the town in the first place place

This allows the Ukrainian forces to observe Russian movements and target them with precision using anti-tank-guided missiles, artillery, and drones.

Furthermore, the Mokri Yaly River and its tributaries, reinforced the Ukrainian defenses, preventing Russian forces from directly approaching Ukrainian positions without pre-established crossing points.

The rivers further complicated Russian logistics, as all the bridges were destroyed during the fighting. slowing down Russian columns as they tried to maneuver through the ruined town. This forced the Russian forces to restrict their movement along predictable roads leading into the northeastern part of the town, which isn’t blocked by any river crossing, preventing the Russian forces from directly approaching Ukrainian positions. without any form of pre-established crossing points.

Lastly as Russians had unleashed the largest artillery bombardment since Vugladar on Velyka Novosilkaka, reducing most of the town’s buildings to ruins.

This is further reinforced by the fact that the withdrawn Ukrainian forces knew which specific buildings in the town provided the best tactical advantages and protection for the Russian forces, so they zeroed in on their artillery, drones, and anti-tank systems to meet the Russian advance.

Combat footage from the area reveals how a Russian column of 8 armored vehicles that were carrying stormtroopers entered the northern part of Velyka Novosilka, where they were immediately targeted by already zeroed-in Ukrainian artillery fire.

Interestingly the footage shows how the first salvo of Ukrainian artillery landed nearly simultaneously indicating that Ukrainians have deployed an entire entire artillery Battalion to focus fire on Russians in Velyka Novosilka. The footage shows that Ukrainians had also used distant mining shells over the town. Subsequently, the lead vehicle struck a landmine, forcing the rest of the column to stop.

Several Russian stormtroopers dismounted from the damaged lead vehicle, trying to establish positions in the high-rise buildings in front of them. However, as the intense shelling continued, the panicking crews of Russian armored vehicles started shooting at the high-rise building, where their soldiers took up positions, thinking that Ukrainian fighters are there instead.

Subsequently, additional footage reveals that after the column was finished off by Ukrainian artillery fire, a few Russian infantry squads scattered within the town. However, the Ukrainian drone operators effectively hunted down the Russian fighters that tried to hide in houses and basements, only for the Ukrainian FPV drone operators to demolish their positions and eliminate them with the shock wave, leaving no survivors.

Overall, the lack of any tactical advantages and poor planning led to a predictable Russian mechanized assault that was effectively countered and eliminated by the Ukrainians. The scale and intensity of Ukrainian precision fire led to tremendous losses among the Russian units, including the elimination of the commander of the 3rd Mechanized Battalion that participated in the assaults.

Such tremendous losses among both foot soldiers and skilled officer cadre will force the Russian command to pause their operations in the Velyka Novosilka area, giving the Ukrainian defenders ample time to adjust and predict their alternative assaults in the future.


11,493 posted on 02/07/2025 2:46:57 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11492 | View Replies]

To: FtrPilot

Let’s talk dimwits 🍈, whether or not NATO was in Ukraine doesn’t give Putin the right to invade.
Putin has troops all over the world, training, and influencing govts.and govt. changes(coup for 🍈)

But for 🍈what’s good for the borscht isn’t good for the gander


11,494 posted on 02/07/2025 3:34:52 PM PST by blitz128
[ Post Reply | Private Reply | To 11486 | View Replies]

To: blitz128
A Russian assault group of about a dozen infantrymen launches a suicide attack on Ukrainian positions riding an unarmored buggy through an empty field swarming with FPV drones.

https://x.com/bayraktar_1love/status/1887994983606538648


11,495 posted on 02/07/2025 4:04:18 PM PST by FtrPilot
[ Post Reply | Private Reply | To 11494 | View Replies]

To: PIF
😈🔥 Night hunting by the 🇺🇦 427th RAROG UAV Regiment with thermal FPV drones in the Chasiv Yar direction.

☠️ KIA - 19 🪦

https://x.com/GloOouD/status/1887952129018515811


11,496 posted on 02/07/2025 4:09:19 PM PST by FtrPilot
[ Post Reply | Private Reply | To 11495 | View Replies]

To: blitz128; PIF; BroJoeK; BeauBo
🍈, whether or not NATO was in Ukraine doesn’t give Putin the right to invade.

Do I hear a Nitwit chirping up? Does the Nitwit have a working knowledge of the Cuban Missile Crisis? How about the Monroe Doctrine? What's good for the goose is good for the gander when national sovereignty is in question. Not to mention NATOs Eastward expansion was agreed upon in 1991 after Germany's unification was agreed to. I've posted all this before, including the relevant documents but obviously if flew over your head, which isn't surprising.

But if all this doesn't interest you, please give us the constitutional authority that allowed Biden to pump more than $200bn dollars into a foreign border war while our own border was allowed to collapse?

NATO: Why Russia has a problem with its eastward expansion

11,497 posted on 02/07/2025 4:12:27 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11494 | View Replies]

To: JonPreston


11,498 posted on 02/07/2025 4:13:16 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11497 | View Replies]

To: JonPreston

11,499 posted on 02/07/2025 4:14:16 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11498 | View Replies]

To: JonPreston

According to the Columbia Journalism Review, USAID supported 6,200 journalists, 707 news outlets and 279 media sector civil society organizations in 30 different countries.

No wonder the news all sounds the same.— Insurrection Barbie (@DefiyantlyFree) February 6, 2025


11,500 posted on 02/07/2025 4:15:06 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11499 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 11,461-11,48011,481-11,50011,501-11,520 ... 22,121-22,134 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson