Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 11,381-11,40011,401-11,42011,421-11,440 ... 20,301-20,320 next last
To: JonPreston

ARREST Victoria Nuland.

“USAID is a CIA front that used $5B in 2014 to ignite a Colour Revolution in Ukraine. Victoria Nuland picked the new Government a month before the old Government was overthrown…” -RFK Jr. pic.twitter.com/YurT0fAEjw— Liz Churchill (@liz_churchill10) February 2, 2025


11,401 posted on 02/05/2025 10:52:46 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11400 | View Replies]

To: blitz128

🍈 posted 8 meaningless memes in a row - its truly a sad day for him. Every one is 😞


11,402 posted on 02/05/2025 11:07:53 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11393 | View Replies]

To: PIF
🍈 posted 8 meaningless memes in a row

Fight like a woman!


11,403 posted on 02/05/2025 12:04:23 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11402 | View Replies]

To: FtrPilot

Condition of the buses you can see leave a little to be desired😂🍈😩


11,404 posted on 02/05/2025 12:13:25 PM PST by blitz128
[ Post Reply | Private Reply | To 11384 | View Replies]

To: PIF

Nice photo of General 🍈.

Soon to receive hero of Soviet Union meme warriors


11,405 posted on 02/05/2025 12:15:08 PM PST by blitz128
[ Post Reply | Private Reply | To 11402 | View Replies]

To: PIF
Arrivals in Primorsko-Akhtarsk, from where Russia constantly launches suicide bombers.

https://x.com/PStyle0ne1/status/1887229371804463216

Primorsko-Akhtarsk on Google Maps


11,406 posted on 02/05/2025 12:51:54 PM PST by FtrPilot
[ Post Reply | Private Reply | To 11402 | View Replies]

To: blitz128
General 🍈 receives Hero of Soviet Union a meme warrior

11,407 posted on 02/05/2025 2:15:03 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11405 | View Replies]

To: FtrPilot; PIF; BeauBo

USAF Rivet Joint spy plane paid a visit to the Black Sea earlier today and was checking out Crimea. First time for US Rivet Joint flight near Crimea in at least 6-8 months.


11,408 posted on 02/05/2025 2:37:38 PM PST by marcusmaximus
[ Post Reply | Private Reply | To 11390 | View Replies]

To: PIF; blitz128

USAID paid actor Ben Stiller $4 million for this meeting with Zelensky 🤦🏻‍♂️

Our tax dollars… hard at work, promoting war.https://t.co/uF3d4FyxEH pic.twitter.com/se4LG3BpX4— MJTruthUltra (@MJTruthUltra) February 6, 2025

https://rumble.com/v6hfkxa-usaid-paid-actor-ben-stiller-4-million-to-meet-with-zelensky.html


11,409 posted on 02/05/2025 4:47:27 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11407 | View Replies]

You have absolutely been lied to and taken for a ride

❗️USAID paid Hollywood stars to travel to Ukraine:

Van Dam - $1,500,000
Ben Stiller - $4,000,000
Sean Penn - $5,000,000
Orlando Bloom - $8,000,000
Angelina Jolie – $20,000,000

⚡️In the words of Elon Musk - "US AID must die."

Surprise >

USAID sent $111.5 million to support… pic.twitter.com/uLZIfJvfzt— 𝐃𝐚𝐯𝐢𝐝 𝐙 (@SMO_VZ) February 5, 2025


11,410 posted on 02/05/2025 5:43:39 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11409 | View Replies]

To: JonPreston

Well Ben ain’t as dumb as he looks. He knows fast money when he sees it.


11,411 posted on 02/05/2025 6:17:36 PM PST by OKSooner ("I'd be safe and warm, if I was in LA... " Mama Cass Elliott, 1966)
[ Post Reply | Private Reply | To 11409 | View Replies]

To: gleeaikin
Russian Offensive Campaign Assessment, February 5, 2025

Ukrainian President Volodymyr Zelensky stated on February 4 that Russian forces have suffered roughly 300,000 to 350,000 killed in action (KIA) and roughly 600,000 to 700,000 wounded in action (WIA) since the February 2022 start of Russia's full-scale invasion of Ukraine.[7] Zelensky added that Russian military personnel suffer a 2:1 wounded to killed ratio because Russian field medicine is poor, and Russian forces struggle to evacuate wounded personnel from the battlefield. Ukrainian Commander-in-Chief General Oleksandr Syrskyi reported on January 20 that Russian forces suffered more than 434,000 casualties in 2024 — 150,000 of which were KIA.[8] Zelensky’s and Syrskyi’s figures indicate that the Russian military suffered roughly 41 to 48 percent of its total casualties in Ukraine since 2022 in 2024 alone. The highest range of Zelensky’s estimates are notably larger than recent Russian casualty figures from the Ukrainian General Staff and former US Defense Secretary Lloyd Austin.[9] Zelensky also stated that roughly 50,000 to 70,000 Russian soldiers have been classified as missing in action (MIA) since February 2022.

Russian soldiers and their relatives continue to complain of poor treatment by the Russian military command and poor provisioning among frontline units. Russian opposition outlet Astra reported on February 5 that over 160 people, most of whom are relatives of soldiers of the Russian 123rd Motorized Rifle Brigade (3rd Combined Arms Army [CAA], formerly 2nd Luhansk People's Republic Army Corps [LNR AC], Southern Military District [SMD]) signed a petition addressed to Russian Defense Minister Andrei Belousov demanding an investigation into the brigade regarding illegal transfers of personnel between units and demanding the removal of the brigade's commander.[76] The Russian military command reportedly replaced the command of the Russian 123rd Motorized Rifle Brigade in November 2024 following a scandal in which the brigade's command submitted inaccurate reports of Russian advances in the Siversk direction, where the 123rd Motorized Rifle Brigade is currently operating.[77] Soldiers of the 9th Company, 3rd Motorized Rifle Battalion of the Russian 15th Motorized Rifle Brigade (2nd CAA, Central Military District [CMD]) also recently recorded an appeal for assistance claiming that they lack adequate food, clothing, and medical supplies, and that their command threatened to conduct drone strikes against their subordinates for failing to report on time.[78] A soldier of the Russian 429th Motorized Rifle Regiment (19th Motorized Rifle Division, 58th CAA, SMD) claimed that his commander beat him after he refused to rotate to a frontline position in the Zaporizhia direction under artillery fire.[79]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-february-5-2025

11,412 posted on 02/05/2025 11:43:29 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11358 | View Replies]




11,413 posted on 02/05/2025 11:45:48 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11294 | View Replies]

1,240 i.e. more than 51 Russians and Norks/h. Vehicles and fuel tanks more than 260%, artillery systems more than 100% above the average.


11,414 posted on 02/05/2025 11:49:58 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11359 | View Replies]

To: marcusmaximus; PIF
Кремлевская табакерка
It's time to deal with Erdogan!

Instead of Russian military bases in Syria, there will now be Turkish ones. This follows from two points: neither Ramzan Kadyrov nor other negotiators from the Russian side have achieved success in negotiations with the new Syrian authorities. The second, even more obvious fact, was proclaimed by the “president” of Syria during the negotiations in Ankara. Ahmed al-Sharaa offered Erdogan to place Turkish military bases in the country. Let's be honest: this is a big defeat for us, not only military, but also political. The interlocutors do not hide their indignation, but there are no real ideas yet on how to change the situation to a more favorable one.

“Erdogan must be punished! He sticks his nose in everywhere and puts spokes in our wheels everywhere,” said a source in the Ministry of Defense associated with work in Syria. It is preliminarily known that Vladimir Putin refused to extradite Bashar al-Assad to the new Syrian authorities.

Another painful point - Erdogan is inciting Azerbaijan to put pressure on Russia over the downed Baku-Grozny flight. Our elites have not yet come up with anything better than to begin preparations for a large-scale expulsion of Azerbaijanis from Moscow to their homeland.

https://t.me/kremlin_secrets/5253

11,415 posted on 02/05/2025 11:56:24 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11408 | View Replies]

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Magyar’s Birds: No One Made it Through - 1,300+ Russian Soldiers, 100+ Tanks, 3,000+ AFVs, APCs & Motorcycles ]

Today [ Feb 05, 8 pm ], there is much news from the Pokrovsk [ Avdiivka ] direction.

Here, Russian forces faced significant challenges in their assaults, due to stiff Ukrainian defenses in their eastern flanking attempt around Pokrovsk, attempted to encircle the city with a massive, mechanized assault.

However, elite Ukrainian drone units ensured that no Russian vehicle could make it to Ukrainian lines, as Russians were caught out in the open.

With their western flanking attempt stalling, Russian commanders sought to bypass urban combat by pushing through the rural terrain near Vozdvyzhenka. Russians continue to try to avoid a prolonged urban battle, as Russians lack the manpower and equipment to sustain heavy losses in house-to-house fighting.

Afraid of Pokrovsk becoming a second Bakhmut, where months of grinding combat led to catastrophic Russian losses, and a complete culmination of all frontline operations after taking the city, Russians prioritized a successful envelopment from the east that would allow to isolate Pokrovsk without engaging in bloody urban combat.

To execute this outflanking maneuver, Russian forces sought to push through a narrow corridor at Vozdvyzhenka using overwhelming mechanized firepower. Recent railway repairs to Ocheretyne allowed them to bring in larger quantities of armored vehicles closer to the front, eliminating the need for lengthy and vulnerable transport and allowing them to concentrate their armor.

Despite this, if we look at the topographic map, we can see that Russian forces faced serious terrain disadvantages. The landscape east of Pokrovsk is unfavorable for armored assault, as the Russians were limited to 2 options to advance, 1 on the high ground where it was less muddy, and 1 on the road in Vozdvyzhenka. These chokepoints restricted their movement, forcing Russian units into predictable paths and making them easy-to-spot targets for Ukrainian artillery and drones.

Additionally, the terrain leading up to Ukrainian positions once they pass this chokepoint is open and exposed, offering no cover for advancing Russian troops. Ukrainian strongholds, particularly near the key underpass, are positioned to provide overlapping fields of fire. This geographical setup created a deadly kill zone where Russian armored columns became an easy target.

Ukraine’s defenders were well-prepared to counter the Russian assault. Thanks to intelligence from aerial reconnaissance and drone units, they anticipated the attack and positioned artillery and FPV drone teams accordingly. Ukrainian forces fired on the advancing Russian column from three directions, completely cutting them down before they could reach Ukrainian lines.

One of the most effective units in this engagement was Magyar’s Birds, one of Ukraine’s most elite drone regiments, whose drone operators have been instrumental in recent battles, and their relentless attacks, aimed at no Russian mechanized unit surviving long enough to reach Ukrainian lines.

The peak of the Russian push occurred near Yelyzavetivka, where they launched a desperate mechanized attack. The assault began with a Russian tank attempting to clear the way, only to be destroyed before making any progress. Following this, 9 more Russian vehicles moved out from Vozdvyzhenka, of which 6 were immediately eliminated, and the remaining 3 were heavily damaged as they tried to retreat.

Not a single Russian vehicle reached the Ukrainian positions. Additionally, Russian infantry attempting to advance on foot were also cut down. The aftermath of the failed Russian offensives is clearly visible in Vozdvyzhenka, where drone footage shows a landscape littered with burned-out Russian vehicles, with their sheer number highlighting the futility of their approach.

Among the wreckage are so-called “Frankenstein” vehicles, makeshift armored carriers cobbled together from salvaged parts. These desperate improvisations underscore Russia’s logistical struggles and continued inability to combat the Ukrainian drone threat.

Overall, Russia’s attempt to outflank Pokrovsk has resulted in heavy losses, with Ukrainian forces once again proving their ability to repel large-scale mechanized attacks.

The geography, Ukrainian tactical positioning, and the devastating effectiveness of Magyar’s Birds ensured that Russian forces were completely cut off and annihilated. The unit’s record speaks for itself, with 4,387 Russian targets destroyed in January alone, among them nearly 100 tanks, hundreds of armored vehicles, and more than a 1,000 enemy soldiers.

Despite Russian logistical improvements, their inability to execute successful assaults in open terrain leaves them at a severe disadvantage. If they continue down this path, their offensive in Pokrovsk risks becoming yet another catastrophic failure.


11,416 posted on 02/06/2025 4:04:35 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11415 | View Replies]

To: marcusmaximus
Ukrainian Minerals For Arms Deal Complicated By Russian Control Of Key Territories
Ukraine Situation Report: More than half of the trillions of dollars in mineral resources is on land controlled by Russia.

Here's another graphic showing rare earths distribution in Ukraine.

11,417 posted on 02/06/2025 4:14:23 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11408 | View Replies]

To: JonPreston; PIF; FtrPilot
JonPreston: "Jamie Raskin and his Ukraine war lobby, demanding more corruption and more bribes for politicians"

USAID aid to Ukraine totaled around $5 billion in 2024, divided among four main categories:

  1. Budget Support: Direct financial assistance Ukraine's government to help maintain essential services and stabilize the economy.

  2. Humanitarian: Funding for food, shelter, medical care.

  3. Economic Recovery: Support for rebuilding critical infrastructure.

  4. Security Assistance: Support for Ukraine's security forces.
Some reports say the President's freeze on foreign aid specifically exempts humanitarian aid to Ukraine: Two days ago, Pres. Trump proposed using Ukraine's mineral resources as security for US loans: Iron ore near Horishni Plavni, Ukraine:


11,418 posted on 02/06/2025 5:14:12 AM PST by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 11340 | View Replies]

To: PIF; AdmSmith

“Russian forces faced significant challenges in their assaults, due to stiff Ukrainian defenses in their eastern flanking attempt around Pokrovsk, attempted to encircle the city with a massive, mechanized assault.”

Perhaps this was the reason for the recent surge in Russian Armor, vehicle and Artillery losses, which we had noted in the daily reports.


11,419 posted on 02/06/2025 6:47:12 AM PST by BeauBo ( )
[ Post Reply | Private Reply | To 11416 | View Replies]

To: FtrPilot; blitz128

France delivers the first Mirage fighter jets to Ukraine, with trained crews

https://freerepublic.com/focus/f-news/4295428/posts

From the article:

“Publisher France24 states the aircraft are the 1990s-upgrade Mirage-2000-5 stock, which were outfitted with a new generation of sensors, electronics, avionics, and other cockpit equipment to make it more combat effective. The aircraft have also been further prepared beyond the improvements they received for service with the French armed forces to incorporate new lessons learnt from the Ukraine war and have been modified to better withstand Russian electronic warfare.

French President Emmanuel Macron had first promised the Mirages in June 2024. Out of the 26 Mirage 2000-5’s that remained in service to cover the transition period between the withdrawal of the Mirage and the introduction of its successor, the Dassault Rafale, six were to be given to Ukraine.

But no indication was given today of how many have been handed over so far, Paris citing security reasons for the secrecy.

The fast training of Ukrainian pilots and ground crews to field the Mirage may stand as something of a rebuke to the British position on donating fighter jets to Ukraine, with London having claimed as it was pointless to try and spend five years bringing Ukrainian pilots up to scratch on British fighters. Instead, the UK joined the so-called fighter jet coalition, backing Belgium, Denmark, the Netherlands, and Norway to give their old F-16s to Kyiv instead.

As reported at the time of the first deliveries of the F-16 to Ukraine, it appeared the United States had carefully managed the deal to prevent American-made jets fighting in the skies over Ukraine. All of the 20-or-so F-16s thought to be in Ukrainian hands now were made under licence at European aircraft factories in the 1990s”


11,420 posted on 02/06/2025 6:59:30 AM PST by BeauBo ( )
[ Post Reply | Private Reply | To 11406 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 11,381-11,40011,401-11,42011,421-11,440 ... 20,301-20,320 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson