Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 11,061-11,08011,081-11,10011,101-11,120 ... 18,901-18,920 next last
To: PIF; blitz128
"I would take issue with those numbers.
Its well known that a Russian troop is highly trained and can take out any martial arts expert with ease.
When it comes to the annual tank face off, the Russian crews always finish 1st, 2nd & 3rd."

From Russian Media Monitor:

In light of all that, it's well worth noticing how well official Russian ambitions match up with their demonstrated military capabilities:

Vladimir Solovyov says Russia will conquer Britain, Germany and France

And this one too, especially towards the end:

Russian Pundits argue about comparing Trump and Putin

11,081 posted on 01/28/2025 5:07:21 AM PST by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 11073 | View Replies]

To: BroJoeK

that was a send off I made up


11,082 posted on 01/28/2025 5:30:37 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11081 | View Replies]

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Russian Human Wave vs. HIMARS Cluster Bombs ]

Today [ Jan 27, 8 pm ], there are a lot of important updates from the Kursk direction.

Here, Russians launched a continued effort in the southern part of the western sector, with Ukrainians turning old Russian fortifications against them, creating brutal kill zones for Russian armor.

To avoid a drawn-out and costly clearing operation, Ukrainians even feigned a weakness, luring the surviving Russian soldiers into a small forest, where HIMARS missiles could rain down fire on them.

The goal of the Russian forces in this area is to take control of the village of Sverdlikovo, which could completely alter the dynamics of the Kursk Salient. As Sverdlikovo is a key position in the outer ring of Sudzha’s defenses, taking control of the settlement would allow Russians to open up direct assaults on the main Ukrainian base of operations in Kursk.

Russians recently pushed Ukrainians out of Nizhny Klin after over a month of intense fighting, which then secured their right flank against possible Ukrainian counterattacks. The main advantage of the Russian forces in this area is the fact that they can accumulate enough forces to achieve numerical superiority, enabled by the many settlements and forests to the north that they now control.

Additionally, the hardened Korenevo-Sudzha road allows the Russian mechanized units to move at full speed to dismount their infantry at Sverdlikovo in rapid succession.

Furthermore, if we take a look at the topographic map, we can see that the terrain elevation in the area around this road is relatively even, allowing Russian forces to move along it without the risk of driving into a crossfire. However, as Russian assault groups get closer to Ukrainian lines, they come within range of Ukrainians on the hillside to the south, where Ukrainians positioned ATGM positions and drone launching pads.

This area is also where Ukrainians, in the initial stages of the Kursk incursion, took control of the Russian defense lines meant to defend the border against Ukrainian assaults.

This defense line consists of a vast network of trenches, bunkers, various underground facilities, and dragon’s teeth anti-tank fortifications. Ukrainians later also moved engineering equipment into Kursk to further fortify the pre-existing defenses and reorient them to defend against Russian assaults from the north instead.

This allows Ukrainians to sit out Russian artillery shelling and aerial bombardments in relative safety without suffering significant losses during this time. The dragon’s teeth fortifications also forced the Russians into a narrow chokepoint, which was already zeroed in by Ukrainian artillery, drones, and anti-tank systems, forming a kill zone.

Combat footage reveals how Russian mechanized formations moved along the road towards the gap in the dragon’s teeth fortifications. As Ukrainians started hitting these vehicles with artillery, drones, ATGMs, and landmines, the wrecks of destroyed armored vehicles quickly piled up, forcing the following vehicles to slow down to maneuver around them.

This allowed the Ukrainian fire to become even more precise, as observation drones continued to correct their fire. Russians even tried sending engineering vehicles of their own to try and move the obstacles out of the way, but they only became a priority target for Ukrainians, as they continued to devastate any Russian assault group driving over the road.

As the Korenevo-Sudzha road quickly turned into a road of death, a number of Russian soldiers managed to survive and scatter into various tree lines and fields in the area. To avoid a lengthy clearing operation, Ukrainians lured and funneled these Russian survivors into a small forest near Sverdlikovo, which they had purposefully left lightly defended.

As the Russian soldiers poured in, in the hopes of accumulating and continuing their assault, Ukrainians unleashed a devastating HIMARS barrage, carpet bombing the forest with cluster munitions in multiple strikes, eliminating the threat of the Russian infantry in one fell swoop.

Overall, the Ukrainians organized a defense in depth, in anticipation of the Russian assaults, luring both Russian vehicles and infantry into brutal kill zones.

The assaults toward Sverdlikovo continue to be one of the most massive Russian mechanized efforts in the Kursk direction, and have resulted in hundreds of Russian soldiers killed and over three dozen destroyed armored vehicles littering the road, only further contributing to the ever-depleting Russian armored reserve.


11,083 posted on 01/28/2025 5:31:43 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11061 | View Replies]

To: PIF
FTA: ...creating brutal kill zones for Russian armor....

Another death alley for ru worms

https://x.com/GirkinGirkin/status/1884137974528692381


11,084 posted on 01/28/2025 5:37:54 AM PST by FtrPilot
[ Post Reply | Private Reply | To 11083 | View Replies]

To: BeauBo; PIF
It appears that previous military aid for Ukraine 🇺🇦 pledged by US 🇺🇸 is still being delivered to Ukraine by the Trump Administration

However, the aid pledged in previous weeks will not last forever, it will be important to see if Trump will sign any new PDA packages for Ukraine

https://x.com/ukraine_map/status/1884020062337786127

I believe President Trump has authority to deliver $2 billion in equipment & ammo which was left over from the last appropriation.

11,085 posted on 01/28/2025 5:42:42 AM PST by FtrPilot
[ Post Reply | Private Reply | To 11084 | View Replies]

To: PIF
As I predicted, the Mexican cartels are already planting IEDs along US highways

Didn't we warn you about the Invasion of America three years ago, but instead your focus remained on Ukraine. Told you so.

11,086 posted on 01/28/2025 6:45:43 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11079 | View Replies]

To: PIF

“As I predicted, the Mexican cartels are already planting IEDs along US highways.”

There is a well worn career path between the Special Forces of the Mexican Military, and their drug cartels. They really believe in hiring vets.


11,087 posted on 01/28/2025 7:46:32 AM PST by BeauBo
[ Post Reply | Private Reply | To 11079 | View Replies]

Russian Offensive Campaign Assessment, January 27, 2025

The European Union (EU) proposed an aid package on January 27 to Moldova and Transnistria to help the ongoing gas crisis in the pro-Russian breakaway republic as part of efforts to reduce Russia's ability to exploit Transnistria in its energy blackmail schemes targeting Chisinau.[4] The package includes an immediate loan of three million cubic meters of gas to Transnistria and offers a grant of 30 million euros (about $31.4 million) for Moldova to purchase gas – presumably from the European market – from February 1 to 10 to support Transnistria’s electricity production for domestic consumption and export to the rest of Moldova. Moldovan Prime Minister Dorin Recean noted that the EU will continue to support Chisinau after February 10 in order to ensure that Transnistria can continue to produce electricity for Transnistria and Moldova. The EU aid package offers to invest in Transnistrian electricity production and distribution over the next two years. The EU stated that it is also considering supporting coal deliveries from Ukraine to Transnistria and that it has supported the allocation of transmission capacity along the gas delivery route from Bulgaria and Romania to Moldova.[5] The Transnistrian Energy Operational Headquarters stated on January 27 that Transnistrian gas reserves are running out and will last only until early February 2025 “at most.”[6]

Russian business outlet Kommersant reported on January 27 that its sources stated that Moldovan gas company Moldovagaz is in discussions with Hungarian oil and gas company MOL and Hungarian electricity company MVM about buying gas for Transnistria, the delivery of which would begin in early February 2025 and continue until late March or early April 2025.[7] Recean confirmed on January 27 that MOL presented Moldovagaz with a draft contract on the supply of gas for Transnistria but that Moldovan authorities must verify the legality and compliance of the contract with national and international law.[8] Transnistrian authorities have previously rejected Moldovan and Ukrainian offers of aid.[9] ISW continues to assess that Transnistria’s possible acceptance of aid from Moldova, Ukraine, or the EU and Transnistria’s subsequent supply of cheaper electricity to the rest of Moldova would disrupt Russian efforts to use the energy crisis to strengthen Transnistria’s economic dependence on Moscow, to posture Russia as the breakaway republic's savior and benefactor, and to leverage Chisinau's turn to higher priced European electricity as part of Moscow's anti-EU narratives.[10]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-january-27-2025

11,088 posted on 01/28/2025 8:12:15 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11058 | View Replies]

To: FtrPilot

Sanctions working again.

OilPrice.com reports today:

“Trade for March-loading Russian oil in China and India has stalled due to soaring shipping costs triggered by U.S. sanctions introduced on Jan. 10, Reuters reported on Jan. 28.

The sanctions target nearly 200 vessels in Russia’s “shadow fleet,” major oil companies, and associated entities, significantly complicating Moscow’s crude exports.

The disruption has led to stalled trade in Russian crude loaded for March delivery as rising shipping costs created a significant price gap between buyers and sellers, according to Reuters.”

(Sanctioned tankers have until 27 Feb to discharge. Non-sanctioned tanker rates have risen millions of dollars higher).


11,089 posted on 01/28/2025 8:18:20 AM PST by BeauBo
[ Post Reply | Private Reply | To 11085 | View Replies]

The Russia-Iran Coalition Deepens
By Karolina Hird and Kitaneh Fitzpatrick

Russia's 2022 full-scale invasion of Ukraine has fundamentally shifted and intensified the Russo-Iranian relationship. Tehran has leveraged Moscow's growing material and financial requirements to sustain its war effort and support Tehran’s own domestic and foreign policy objectives. The core of the Russo-Iranian relationship is a mutually binding interest in challenging and eventually overturning the US-led world order. This shared ideological core allowed the Russo-Iranian relationship to weather and survive tensions and challenges that have arisen since 2022, and the United States should not expect this ideological core to weaken in the years ahead. Russo-Iranian cooperation is occurring along seven major axes that relate to and overlap in the defense, economic, and political spheres. It is also not a perfectly one-to-one relationship—Moscow and Tehran are seeking different outcomes from their collaboration. The interrelated nature of these nodes of cooperation should emphasize to the United States and its allies that the success of Russia cannot be separated from the success of Iran.

https://www.understandingwar.org/sites/default/files/The%20Russia-Iran%20Coalition%20Deepens.pdf
40 pages

11,090 posted on 01/28/2025 8:19:46 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11088 | View Replies]


11,091 posted on 01/28/2025 8:24:09 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11005 | View Replies]

To: BeauBo

There is a well worn career path between the Special Forces of the Mexican Military, and their drug cartels. They really believe in hiring vets.


Los Zetas began as a well-trained and financed US counter-cartel group, but massive money quickly changed the group to a cartel.


11,092 posted on 01/28/2025 8:42:25 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 11087 | View Replies]

1,380 i.e. more than 57 Russians and Norks/h. Vehicles and fuel tanks 150% above the average.


11,093 posted on 01/28/2025 8:52:57 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11059 | View Replies]

To: BeauBo
BURNING CASH: Russian propagandists notice that Russian oil infrastructure is burning.

As tools of Putin, they begin to float the idea that oil oligarchs should pay for increased anti-aircraft defenses.

Mark my word, this is when Putin's oligarchs will start to turn on Putin.

https://x.com/ChuckPfarrer/status/1884276274597880150


11,094 posted on 01/28/2025 9:26:35 AM PST by FtrPilot
[ Post Reply | Private Reply | To 11089 | View Replies]

To: BeauBo

To: JonPreston

It seems likely that Speedy may have died.

No one has heard from him, and Free Republic does draw an older crowd.

If that is the case, your posts about him are particularly distasteful and ghoulish.

Personal trolling in any event, is a violation of the rules.

9,639 posted on 12/15/2024 9:16:00 AM PST by BeauBo

11,095 posted on 01/28/2025 9:50:52 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11089 | View Replies]

Why on earth would an American man believe this THING is capable of negotiating a Ukranian Peace?

Kallas comes across as painfully out of her depth yet represents 450 million EU citizens. Promoted far beyond her abilities.

By talking about breaking Russia into little pieces, she's basically backing up the Kremlin’s point that NATO expansion on its borders is "a threat.” 🤔

https://t.co/O0q0XLtWPF— Brian McDonald (@27khv) January 27, 2025


11,096 posted on 01/28/2025 9:53:41 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11095 | View Replies]

To: JonPreston

KIEV corruption.

Deputy of @Vitaliy_Klychko arrested with $1’000’000 bribe in cash.

Klychko's team selling land n Kyiv for hundreds of millions of dollars every year.

Everyone knows, but no one can do anything because West supports Klychko.

BUT Zelensky doesn’t like… pic.twitter.com/j0DBozt4K2— Diana Panchenko 🇺🇦 (@Panchenko_X) December 26, 2024


11,097 posted on 01/28/2025 9:54:49 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11096 | View Replies]

To: JonPreston

Ukraine was the most corrupt country in the world in Pandora Papers leak. With 38 people including Zelensky.

Zelensky's childhood friend Ivan Bakanov, former head of the security service of Ukraine was also on the list. pic.twitter.com/aMuNTL0iSi— Global Thinker (@talkrealopinion) June 2, 2023


11,098 posted on 01/28/2025 9:55:26 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11097 | View Replies]

To: JonPreston

If we want reckoning for Covid, it’s imperative that we get RFK Jr. and Tulsi confirmed.

RFK Jr. and Tulsi were the two most vocal public figures about US-funded bioweapon development in Ukraine.



They know where this trail ends, which is why the establishment fear them. pic.twitter.com/uxFeFxzQBP— Clandestine (@WarClandestine) January 27, 2025


11,099 posted on 01/28/2025 9:56:02 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11098 | View Replies]

To: JonPreston
Trump suggests Ukraine shouldn't have fought back against Russia

LINK

Trump has argued that Zelenskyy should have made a deal with Russian President Vladimir Putin to avoid the war...."I could have made that deal so easily, and Zelenskyy decided that 'I want to fight,'" Trump said.

11,100 posted on 01/28/2025 9:57:14 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 11099 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 11,061-11,08011,081-11,10011,101-11,120 ... 18,901-18,920 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson