Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 10,961-10,98010,981-11,00011,001-11,020 ... 22,141-22,151 next last
To: PIF
According to Russian channels, over 130 drones attacked Russia last night. One of the largest attacks since the start of the invasion.

The "Kremniy" factory near Bryansk, which produces microchips and other electronics for Russia's military complex, was hit. In Ryazan: oil refineries, pumping stations, and a thermal power plant are on fire. The refinery processes ~17 million tons of oil per year.

There were also explosions and air defense activity reported near Dyagilevo and Engels-2 airbases, but there is no damage confirmation yet.

The Russian Ministry of Defense claimed the destruction of over 120 drones.

https://x.com/NOELreports/status/1882744691923280143

Awaiting further Battle Damage Reports.

10,981 posted on 01/24/2025 5:08:55 AM PST by FtrPilot
[ Post Reply | Private Reply | To 10980 | View Replies]

To: PIF; BeauBo; AdmSmith; blitz128; marcusmaximus
Additional BDA:

💥 Details about the night attack on Russia.

❗️UAVs strikes one of the largest oil refining facilities in Russia - Ryazan oil Refinery, as well as Ryazan CHPP.

🔥 At least three tanks are on fire at the refinery, as well as a workshop with a hydrotreating unit for diesel fuel and aviation kerosene.

‼️ The General Staff also confirmed strike on Kremniy El microelectronics plant in Bryansk. It produces, in particular, microcircuits and components for the Topol-M and Bulava complexes, the S-300 and S-400 systems, as well as for the onboard electronics of combat aircraft. The plant has suspended its work.

https://x.com/UkrReview/status/1882731905277202783

I am surprised at the "exactness" of this report.

My guess is this is from open/unencrypted satellite communications.


10,982 posted on 01/24/2025 5:24:24 AM PST by FtrPilot
[ Post Reply | Private Reply | To 10981 | View Replies]

To: JonPreston; FtrPilot; BeauBo; AdmSmith; PIF
"Trump has argued that Zelenskyy should have made a deal with Russian President Vladimir Putin to avoid the war...."I could have made that deal so easily, and Zelenskyy decided that 'I want to fight,'" Trump said."

I saw that last night on Hannity.

However:

  1. Pres. Trump has repeatedly said Putin should never have invaded Ukraine, and wouldn't have, while Trump was president.

  2. Trump has not placed any restrictions on Ukrainian attacks into Russia.

  3. Nor has Trump halted deliveries of American aid to Ukraine.

  4. Trump has also demanded Europeans increase their defense spending to 5% of GDP, to defeat whatever Russians might throw at them.
Bottom line: there is no doubt that Trump wants a peace deal in Ukraine -- and God bless him for that -- and will do and say what he thinks necessary to achieve it.

How favorable those terms will be for Ukraine or Russia is what's being negotiated, sometimes publicly, sometimes privately.

10,983 posted on 01/24/2025 5:24:47 AM PST by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 10976 | View Replies]

To: BroJoeK
"Trump has not placed any restrictions on Ukrainian attacks into Russia."

Worth repeating.

10,984 posted on 01/24/2025 5:37:01 AM PST by FtrPilot
[ Post Reply | Private Reply | To 10983 | View Replies]

To: FtrPilot

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Ukrainians Strike Back! Russian Forces Crumble in Kotlyne! ]

Today [ Jan 23, 8 pm ], the biggest news comes from the Pokrovsk direction.

Here, Ukrainian forces launch a daring counterattack to retake Kotlyne, exploiting the exhausted and disorganized Russian troops in a methodical assault. With Russian forces so depleted that even the wounded were forced to fight, these tactics chip away at Russian forces’ combat capabilities while forcing more Russians to hurl themselves into the meat grinder.

With Russians recently taking tactically valuable positions in Kotlyne, Ukrainian forces initiated a series of counterattacks to retake the settlement from Russian forces with overwhelming firepower. The main advantage of Kotlyne is that it is located on both sides of the railway line, with a dense tree belt running through it.

The industrial plant to the north provides strong structures, large buildings, and underground facilities, providing protection from artillery shelling, and allowing for the deployment of forces and ammunition depots. This means that controlling this settlement is a crucial advantage to both Russians and Ukrainians in the larger battle for Pokrovsk.

To retake it, Ukrainians planned a complex assault operation into the village through the combined efforts of sappers, tank crews, and assault groups. However, with Russians controlling a large portion of the settlement and industrial zone’s defensive advantages, this would not be an easy task.

On the other hand, as you remember from a previous report, Russian forces were already so short on available manpower for their assaults that they had to send their wounded into battle on crutches. Unfortunately for Russians, Ukrainians planned to exploit this, as it showed that Russian soldiers manning the frontline were in bad shape, and would not be at all prepared to provide adequate resistance against a well-organized Ukrainian mechanized counterattack.

The main advantage of the Ukrainian forces was their launching point in the city of Pokrovsk, whose large size allowed them to accumulate enough forces to launch a counterattack, in relative safety, against Russian detection.

Furthermore, the proximity of Pokrovsk to Kotlyne meant that Ukrainians could quickly launch their counterattack, before the Russians could send reinforcements or prepare their defense. With no space to hide any armor, the Russian contingent in Kotlyne consisted only of infantry, making them vulnerable to direct fire from Ukrainian armored vehicles.

Lastly, the fact that Russians had rushed into the Kotlyne industrial district, meant that their flanks had been left dangerously exposed. With continued Ukrainian control over Udachne, the coal mine, the fields to the north, and Pokrovsk itself, the Russian contingent in Kotlyne had to take up an all-round defense, preparing to repel assaults from all directions, while Ukrainians could observe Russian defenses from all sides.

Ukrainians took advantage of this weakness by concentrating their push on the southern portion of Kotlyne in a calculated assault from Pokrovsk, breaking through the Russian weak point.

The attack started with a team of fighters conducting reconnaissance, scouting out Russian anti-tank mines and firing positions. After Ukrainian sappers cleared the road of mines, Ukrainians conducted a rapid tank raid, targeting Russian positions and destroying them with direct fire from the main gun.

Subsequently, Ukrainian armored vehicles deployed an assault group to storm the suppressed Russian positions. While Russians initially tried to resist the Ukrainian assault, they were quickly overwhelmed by grenades; whereafter the Ukrainian assault group cleared the buildings with small arms fire.

Simultaneously, a second Ukrainian assault group was deployed to strike and clear Russian trenches just outside the village, securing the flank of the first group. Once the operation was complete, additional Ukrainian reinforcements arrived to hold the newly captured village while the assault groups were evacuated.

Overall, the tremendous losses suffered by the Russians in their previous assaults, coupled with a large number of incapacitated soldiers, prevented them from providing adequate resistance to the Ukrainian counterattack, resulting in Ukrainians retaking Kotlyne from the Russians. With this, Russian forces that had rushed into the northern industrial zone found themselves in operational encirclement, entirely cut off from reinforcements.

Continued operations like this will undermine Russian offensive momentum and put an even greater strain on their already limited reserves. Russians either become encircled and destroyed, or are forced to commit an even greater number of soldiers to retake settlements they lose to Ukrainian counterattacks.


10,985 posted on 01/24/2025 5:41:06 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10980 | View Replies]

To: PIF

Yet another video appeared on Russian Telegram channels that reportedly shows injured and sick Russians being sent into meat assaults.

When you read about Russian frontline advances, remember at what cost it comes - tremendous neglect of human lives.

https://bsky.app/profile/antongerashchenko.bsky.social/post/3lgif47g2rc2d


10,986 posted on 01/24/2025 5:47:12 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10985 | View Replies]

To: AdmSmith

These two videos come highly recommended for 🍈 & his 🦠 friends.


10,987 posted on 01/24/2025 7:47:21 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10986 | View Replies]

To: BroJoeK; PIF; blitz128

Thank you for replying to me, BroJoeK. As Ukraine continues to collapse, I feel some Zeepers will begin to see the light and move to rationality. Others unfortunately will remain dopey. Never, ever go Full Dopey.


10,988 posted on 01/24/2025 8:51:25 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10983 | View Replies]

To: BroJoeK

All of us try to avoid commenting to 🍈 as he just brings more of his 🦠 friends. At present, his aim seems to be to discourage anyone reading this thread by posting inane graphics and 🦑-like comments


10,989 posted on 01/24/2025 9:12:26 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10983 | View Replies]

To: PIF; BeauBo; FtrPilot

Let’s see if President Trump calls Putin today from AF1 en route from NC to CA.


10,990 posted on 01/24/2025 10:55:02 AM PST by marcusmaximus
[ Post Reply | Private Reply | To 10989 | View Replies]

To: BroJoeK

President Trump will increase the costs of the war on the Russian people and economy until Putin has no choice but to stop his genocidal war of choice or risk the fall of his illegitimate regime.


10,991 posted on 01/24/2025 11:25:59 AM PST by lodi90
[ Post Reply | Private Reply | To 10983 | View Replies]

To: BroJoeK; PIF
Don't pay attention to Mother Hen PIF. This is a forum, and grown men can talk as they wish. Thoughts on your government trying to kill its own citizens?

🚨🇺🇸SHOCKING CIA DOC REVEALS US MILITARY'S PLOT TO KILL AMERICANS

A declassified CIA document reveals that in the 1960s, the US military planned Operation Northwoods, which involved committing acts of terrorism against American citizens to justify a war with Cuba.

The plot… pic.twitter.com/2clGtvJ6i6— Mario Nawfal (@MarioNawfal) January 24, 2025


10,992 posted on 01/24/2025 11:26:16 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10983 | View Replies]

To: lodi90

The war started in 2014, and probably earlier.


10,993 posted on 01/24/2025 11:27:06 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10991 | View Replies]

To: PIF

Kremlin gaslighting attempts are good for comedy, though. Anybody with a shred of knowledge and common sense can see that buffoonery for what it is.


10,994 posted on 01/24/2025 11:29:09 AM PST by lodi90
[ Post Reply | Private Reply | To 10989 | View Replies]

To: lodi90
This is your government, the same one who killed more than one million innocent Ukrainians needlessly in a war that never should have started

The US military planned a false flag called Operation Northwoods to start a war with Cuba. JFK rejected it.https://t.co/0XVkx892nj— Larry Schweikart (@LarrySchwe94560) January 24, 2025


10,995 posted on 01/24/2025 11:35:06 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10994 | View Replies]

To: FtrPilot

Reports of USAF C-17 flight from Israel directly to Poland are interesting. That is almost certainly high value cargo.


10,996 posted on 01/24/2025 11:35:41 AM PST by lodi90
[ Post Reply | Private Reply | To 10984 | View Replies]

To: lodi90

“Reports of USAF C-17 flight from Israel directly to Poland are interesting”

There were earlier reports that Israel was considering donating the Russian Military gear they captured from Hamas, to Ukraine.


10,997 posted on 01/24/2025 11:42:00 AM PST by BeauBo
[ Post Reply | Private Reply | To 10996 | View Replies]

To: BeauBo

Israel flight very interesting. Also, more ammunition delivery flights today from US and Italy to Poland, for delivery to Ukraine.


10,998 posted on 01/24/2025 11:54:43 AM PST by marcusmaximus
[ Post Reply | Private Reply | To 10997 | View Replies]

To: marcusmaximus

Possibly some recently retired PAC-2 missiles, or some components of a Patriot battery.


10,999 posted on 01/24/2025 12:13:00 PM PST by ETCM (“There is no security, no safety, in the appeasement of evil.” — Ronald Reagan)
[ Post Reply | Private Reply | To 10998 | View Replies]

To: Bopeep

11,000 posted on 01/24/2025 1:25:07 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10995 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 10,961-10,98010,981-11,00011,001-11,020 ... 22,141-22,151 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson