Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 10,901-10,92010,921-10,94010,941-10,960 ... 18,761-18,775 next last
To: PIF
"UNBELIEVABLE: Wounded Russians SENT TO ATTACK ON CRUTCHES!!"

PIF, do you believe this one too?


10,921 posted on 01/22/2025 6:33:53 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10920 | View Replies]

To: PIF; ansel12

“Ukraine Is Burning Through 155mm M777 Howitzer Barrels So Fast”

Send more Artillery!

Ukraine is really getting the job done.

30 replacement barrels per month, would indicate about 2,500 rounds per day, just through the M777s, and they are surpassing that.

Ukrainian Artillery has really picked up the pace from earlier in the war, and is now around on par with Russia’s Artillery firepower - but faster, more accurate and with longer range.

Kind of a big deal.


10,922 posted on 01/22/2025 6:58:48 AM PST by BeauBo
[ Post Reply | Private Reply | To 10918 | View Replies]

The Putin woke up one morning and decided to cut off the gas to Europe. "But freedom came at a price." Ursula took on The Putin and is now ready to challenge Trump.
The EU is SO BACK 🤣🤣🤣

pic.twitter.com/WgfIGAulwY— Alex Christoforou (@AXChristoforou) January 22, 2025


10,923 posted on 01/22/2025 7:32:44 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10921 | View Replies]

To: BeauBo

Kremlin snuff box, 1/22/24
https://t.me/s/kremlin_secrets

There were rumors at the front that the SVO would end before the summer

Such information is discussed by military personnel in different sectors of the front, familiar officers told us.

“I heard from several fighters: they believe that Vladimir Vladimirovich will soon have negotiations with Trump [ https://t.me/kremlin_secrets/5192 ], the fighting will end before the summer, and the military will go home. I can’t understand where the guys got this information from. They answer: “Everyone is talking about it,” said a military man who is now in the Kursk region.

And the officer who releases the DPR noted: “I don’t know what kind of bastard planted this information, but I would have a heart-to-heart talk with him. Many military men hope so much for the end of the North Military District that they will soon stop wanting to go into battle. And really, why die if everything will end soon? You can’t do that!”

The Ministry of Defense refused to comment on this information. They urged “not to collect gossip about the front.”

But we must note the following. that rumors about the imminent end of hostilities have appeared among the military This is not the first time [ https://t.me/kremlin_secrets/4898 ].

So far, no one can say whether the enemy is spreading them on purpose or whether the tired fighters really hope to return home to their families. It is possible that both of these factors are at work.


10,924 posted on 01/22/2025 7:34:13 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10922 | View Replies]

To: SpeedyInTexas

🍈 is having another bad day.


10,925 posted on 01/22/2025 7:36:06 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10905 | View Replies]

To: BeauBo
Ukraine is really getting the job done.

Not so fast. These 500,000 new troops are replacements for the nearly 1,000,000 Ukrainians killed and wounded.


10,926 posted on 01/22/2025 7:36:58 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10922 | View Replies]

To: PIF

PIF, where if blitz? Word at the front is that he has a bit of agita after his latest booster shot. You’ll have to pick up the posting effort during his absence but hold off on the subscription nonsense. Ukraine Propaganda should be free of charge.


10,927 posted on 01/22/2025 7:42:33 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10924 | View Replies]

To: PIF
Russian Offensive Campaign Assessment, January 21, 2025

Russian President Vladimir Putin and People's Republic of China (PRC) President Xi Jinping held a phone call on January 21 and emphasized deepening cooperation. Putin and Xi reiterated boilerplate narratives emphasizing increasing Russian-PRC foreign policy, energy, and economic cooperation.[14] Russian Presidential Aide Yuri Ushakov claimed that Putin and Xi discussed Russia's war in Ukraine and Russia's and the PRC's relations with the United States, although the official Kremlin readout of the call did not mention these topics.[15] Ushakov also claimed that Xi gave Putin an overview of Xi's recent call with US President Donald Trump.[16]

Russian ultranationalist milbloggers renewed complaints against the Russian MoD for failing to hold the Russian military command accountable for military failures. The milbloggers complained that the Russian MoD sends Russian generals to Syria “in exile” but that the generals do not have to answer for major battlefield failures, including the failed Russian offensive against Vuhledar, Donetsk Oblast in Winter 2022 that suffered extremely high casualties; the failed defense against the Ukrainian counteroffensive in Kharkiv Oblast in Fall 2022; and failures to defend against Ukraine's incursion into Kursk Oblast starting in August 2024.[76] One milblogger complained about Russian air defenses failing to defend against Ukrainian drone and missile strikes deep in the Russian rear.[77] Another milblogger specifically criticized Russian authorities for prosecuting Major General Ivan Popov – whom Russian authorities arrested in May 2024 on charges of fraud after Popov publicly criticized Russian Chief of the General Staff Army General Valery Gerasimov – while other Russian generals remain free.[78] Russian command failures have periodically prompted a backlash in the Russian ultranationalist information space, but less so following Kremlin efforts throughout 2024 to encourage self-censorship among the milblogger community.[79] A revival of complaints directed specifically against the military command and invoking Popov, whose arrest sparked intense backlash within this community at the time, is notable.[80]

Russian authorities continue to use financial incentives to increase voluntary military recruitment. Mari El Republic Head Yuri Zaitsev stated on January 20 that he is raising the one-time regional payment to volunteer recruits who join the Russian military or Rosgvardia from 1.4 million rubles (about $14,000) to 1.8 million rubles (about $18,000).[81] Zaitsev stated that Russian soldiers called up during conscription cycles who choose to sign a contract with the Russian MoD will receive a one-time payment of one million rubles (about $10,000). The Russian MoD’s Africa Corps posted a recruitment ad on January 20 offering one-time payments of 1.9 million rubles (about $19,000) to those who sign a MoD contract in Moscow City and Oblast and 1.7 million rubles (about $17,000) to those who sign in St. Petersburg.[82]

more text + maps
https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-january-21-2025

10,928 posted on 01/22/2025 8:30:37 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10891 | View Replies]

1,950 i.e. more than 1.35 Russians and Norks/min. Artillery systems are 3 times the average and vehicles and fuel tanks about 5 times. This suggests that the Russians attempted an attack, but that the result was large deliveries to the Great Meat Grinder and its cousin the Great Equipment Destroyer.


10,929 posted on 01/22/2025 8:52:59 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10892 | View Replies]

To: BeauBo

Donald J. Trump@realDonaldTrump
https://truthsocial.com/@realDonaldTrump/posts/113872782548137314

I’m not looking to hurt Russia. I love the Russian people, and always had a very good relationship with President Putin - and this despite the Radical Left’s Russia, Russia, Russia HOAX.

We must never forget that Russia helped us win the Second World War, losing almost 60,000,000 lives in the process. All of that being said, I’m going to do Russia, whose Economy is failing, and President Putin, a very big FAVOR.

Settle now, and STOP this ridiculous War! IT’S ONLY GOING TO GET WORSE. If we don’t make a “deal,” and soon, I have no other choice but to put high levels of Taxes, Tariffs, and Sanctions on anything being sold by Russia to the United States, and various other participating countries.

Let’s get this war, which never would have started if I were President, over with! We can do it the easy way, or the hard way - and the easy way is always better. It’s time to “MAKE A DEAL.” NO MORE LIVES SHOULD BE LOST!!!


🍈 & 🦠s please note the above message.


10,930 posted on 01/22/2025 8:55:41 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10922 | View Replies]

To: AdmSmith

823.9K and going for 1 million casualties - Putin is a military genius


10,931 posted on 01/22/2025 8:57:36 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10929 | View Replies]

To: PIF
“We see you, we know what you're doing and we will not shy away from robust action to protect this country”. Royal Navy vessels have been tracking a Russian spy ship in the English Channel just weeks after it was caught loitering over critical undersea infrastructure.

https://x.com/DefenceHQ/status/1882089642696347932

Royal Navy tracking Russian spy vessel in the Channel to keep UK safe The UK will also contribute maritime patrol and surveillance aircraft to bolster a NATO response after damage to undersea cables in the Baltic Sea

https://www.gov.uk/government/news/royal-navy-tracking-russian-spy-vessel-in-the-channel-to-keep-uk-safe

Yantar position https://www.vesselfinder.com/?imo=7524419

10,932 posted on 01/22/2025 9:03:36 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10797 | View Replies]

To: AdmSmith

Here is the report brought to you free which 🍈 and his 🦠 pals were demanding to see.

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Wounded Russians Sent to attack in Crutches! ]

Today [ Jan 21, 8 pm ], there are a lot of interesting updates from the Pokrovsk direction.

Here, the new Russian assault vector sees Russian generals desperate to keep up their momentum, throwing undertrained soldiers into relentless day-and-night human wave assaults.

With losses so severe, Russians have even sent wounded soldiers on crutches back into battle, resulting in bodies of fallen soldiers slowly piling up in the fields.

The goal of the Russian forces in this area is to take the town of Udachne and the open fields around it, creating a staging ground for the encirclement of Pokrovsk from the western flank of the city. Russian forces are forced to go around, as they lack the reserves necessary to launch frontal assaults on Pokrovsk.

The Institute for the Study of War recently stated that Russians are sending newly recruited soldiers straight to the frontline with barely a few weeks of basic training, underscoring the Russian manpower issue. Furthermore, Russians lack the sufficient air support needed to dismantle and eliminate Ukrainian forces holding up in fortified high-rise buildings and industrial zones.

To take Udachne, Russian forces rely heavily on pure infantry assaults to storm the Ukrainian positions across the field to reach the town.

These infantry assaults are usually made up of groups of up to 3 soldiers, 15 to 20 meters apart, to reduce the risk posed by Ukrainian FPV kamikaze drone strikes. Reports from Ukrainian soldiers on the ground indicate that Russians launch these assaults around the clock, putting intense pressure on Ukrainian defenders, while at a high cost in human life.

Russians use the terrikon north of Novovasylivka to observe Ukrainian positions in Udachne and the surrounding area. Russian forces, accumulated in Solone and Novovasylivka, then move through the tree lines and open fields to attack Udachne directly, while the Solona River shields Russian assault groups from direct Ukrainian counterattacks from below.

However, the Russian assault groups move at a slow pace as they are on foot, which means that the Ukrainian drone operators can quickly detect the Russian assault groups while they are still on the approach. This has led to Ukrainians relying heavily on drone units to monitor and eliminate the Russian infantry, eliminating the Russian infantry assaults with deadly efficiency.

As the Russian assault groups are also very small, they generally do not have the required weight to breach Ukrainian defenses; instead, they form a constant stream of attackers that are meant to overwhelm Ukrainians in the long run.

However, this has turned out to be a very costly strategy for the Russians, precisely because the small infantry groups don’t have the hitting power of a larger assault. This makes them easier to deal with individually, as Ukrainians inflict up to 400 Russian casualties a day in the Pokrovsk direction alone.

Combat footage of a Ukrainian drone operator in the area reveals the reality of Russian assaults where dozens, if not hundreds, of dead Russian soldiers are scattered across the fields south of Udachne. To make it worse, Russians often can’t or don’t retrieve their wounded, leaving them to die in the fields instead. Russian commanders were, however, in dire need of reserves to keep up the momentum of the assaults.

In desperation, they even ordered their wounded soldiers back into the fight, as footage shows how 2 wounded Russian soldiers were walking through the fields on crutches toward Ukrainian positions, without communicating any intent to surrender. While these Russian soldiers could barely walk, they were still assaulting Ukrainian positions, leaving Ukrainian drone operators little choice but to eliminate them regardless.

Overall, the Russian offensive effort on the western flank of Pokrovsk is rapidly becoming unsustainable for the Russians due to the high attrition rates of their tactic. Russian voluntary recruitment is at an all-time low, with Russians having to promise outlandish signing bonuses to sign new recruits, with Russian soldiers reporting they use their signing bonus to pay off their commanders so they do not have to go on assault.

This all underlines the Russian issue of high casualty rates that often far exceed the pre-war populations of the towns that are being fought over, with Russians consistently losing men in the thousands just to take one village.


10,933 posted on 01/22/2025 10:31:32 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10932 | View Replies]

To: PIF

“really, why die if everything will end soon?”

Russian grunts hanging on Trump’s every word…

Home before Christmas.


10,934 posted on 01/22/2025 12:17:57 PM PST by BeauBo
[ Post Reply | Private Reply | To 10924 | View Replies]


10,935 posted on 01/22/2025 12:32:51 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10927 | View Replies]

To: blitz128; PIF; BeauBo; betty boop

10,936 posted on 01/22/2025 12:40:15 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10935 | View Replies]

To: JonPreston; PIF

No more money to Russia.

President Trump: “If we don’t make a “deal,” and soon, I have no other choice but to put high levels of Taxes, Tariffs, and Sanctions on anything being sold by Russia”

Trump sized Taxes, Tariffs, and Sanctions.

Overwhelming.

FAFO.


10,937 posted on 01/22/2025 12:55:58 PM PST by BeauBo
[ Post Reply | Private Reply | To 10935 | View Replies]

To: BeauBo

I would like to see the EU completely collapse before The Trump hammers Russia. Watching the European globalists commit national suicide is truly a thing of beauty.


10,938 posted on 01/22/2025 1:05:33 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10937 | View Replies]

To: SpeedyInTexas

https://x.com/harryjsisson/status/1881749220396499184?t=Bm8yMxs_BZ4u8Zzg8zqR2w&s=19

Cute.
You get that from hairy sissy?


10,939 posted on 01/22/2025 1:32:36 PM PST by Darksheare (Those who support liberal "Republicans" summarily support every action by same. )
[ Post Reply | Private Reply | To 10905 | View Replies]

To: JonPreston

It doesn’t matter what you would like.

Trump is in charge now, and little Putin will have to do as he is told, or else.

It’s over.


10,940 posted on 01/22/2025 1:36:44 PM PST by BeauBo
[ Post Reply | Private Reply | To 10938 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 10,901-10,92010,921-10,94010,941-10,960 ... 18,761-18,775 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson