Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 10,721-10,74010,741-10,76010,761-10,780 ... 22,161-22,169 next last
To: BeauBo

Good news: StarShip booster was caught for the second time.
Bad news: one of the non-gimbaling StarShip engines kept burning after cut off and the ship went into a spin and broke up over the Caribbean.


10,741 posted on 01/16/2025 3:09:15 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10739 | View Replies]


10,742 posted on 01/16/2025 3:27:30 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10740 | View Replies]

Marco Rubio: Ukraine Must Make Concessions to End War With Russia

Florida Senator Marco Rubio, who is President-elect Donald Trump's pick for secretary of state, said "there will have to be concessions made" by Ukraine to end the ongoing war with Russia.


10,743 posted on 01/16/2025 3:39:24 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10742 | View Replies]

To: PIF

🍈’s claims on Norks won’t age well
Like Russia has all the equipment, ammunition, cash, and manpower it will ever need.
I believe they used the term self-sufficient

The idea that Russia is using Norks seems to have hit a nerve😎


10,744 posted on 01/16/2025 4:38:59 PM PST by blitz128
[ Post Reply | Private Reply | To 10741 | View Replies]

To: BeauBo

lol what’s a “glow”?


10,745 posted on 01/16/2025 4:41:21 PM PST by blitz128
[ Post Reply | Private Reply | To 10739 | View Replies]

To: blitz128

“🍈’s claims on Norks won’t age well”

An over the top obvious lie. (That there are no North Koreans participating in combat against Ukraine)

Must be some consequences that they (Russians) are desperate to avoid, so they are wantonly sacrificing the credibility of their Internet trolls (what little they have) by having them push such ridiculous claims.

But it is not the first time, by far (Globohom Nazi BioLab much?). Must be nearing time for a new screen name.

They certainly do not lack for Chutzpah.


10,746 posted on 01/16/2025 7:23:06 PM PST by BeauBo
[ Post Reply | Private Reply | To 10744 | View Replies]

Russian Offensive Campaign Assessment, January 16, 2025

The entire North Korean contingent of roughly 12,000 personnel currently in Kursk Oblast may be killed or wounded in action by mid-April 2025 should North Korean forces continue to suffer from their current high loss rate in the future. Ukrainian President Volodymyr Zelensky stated in early January 2025 that 3,800 North Korean personnel had been killed or wounded in Kursk Oblast.[6] Ukrainian Defense Minister Rustem Umerov stated on November 5, 2024 that North Korean forces were engaged in “small-scale” clashes in Kursk Oblast, but Russian milbloggers began claiming on December 6 that North Korean forces were participating in more significant combat operations.[7] North Korean have therefore likely suffered roughly 92 casualties per day since starting to participate in significant fighting in early December 2024. North Korea reportedly transferred roughly 12,000 North Korean personnel to Kursk Oblast, and the entirety of this North Korean contingent in Kursk Oblast may be killed or wounded in roughly 12 weeks (about mid-April 2025) should North Korean forces continue to suffer similarly high casualty rates in the future.[8] South Korea's National Intelligence Service (NIS) stated on January 13 that so far 300 North Koreans have been killed in action and 2,700 have been wounded in action in Kursk Oblast.[9] North Korean forces will likely continue to suffer a larger ratio of wounded to killed in action - as is typical for armed conflict - and it is unclear if or when injured North Korean soldiers return to combat.

Ukrainian President Volodymyr Zelensky and UK Prime Minister Keir Starmer signed a landmark “Centennial Partnership Agreement” on January 16 outlining Ukrainian-British cooperation for the next 100 years and continued UK support to Ukraine.[10] The agreement outlines the UK's commitment to Ukraine's possible future NATO membership as a means to guarantee Ukraine's security and calls for strengthening bilateral defense and security ties, building consensus on Ukraine's NATO membership prospects, enhancing maritime security, expanding economic and trade cooperation, and boosting collaboration in the energy, climate, and justice spheres. Starmer highlighted during a press conference on January 16 that the UK intends to provide military aid to Ukraine annually and will provide Ukraine with a loan backed by funds from frozen Russian assets.[11] Starmer highlighted that the UK will also expand its training program for Ukrainian military personnel and provide Ukraine with 150 artillery barrels and a new Danish-funded mobile air defense system.[12]

A Russian milblogger and former Storm-Z instructor continued to complain on January 16 about Russian infantry shortages and high loss rates.[70] The milblogger claimed that the Russian military's current shortage of infantry soldiers initially stemmed from heavy losses in Spring and Summer 2022 and delays in announcing the partial reserve callup in September 2022.[71] The milblogger complained that Russian forces were able to regain the initiative in Fall 2023 but then there was no significant force buildup in 2024, so Russia's current offensive operations are “eating up reinforcements like crazy.” The milblogger attributed Russia's high casualty rates to poor combat planning and organization, including problems in interbranch cooperation, due to insufficient communication and aerial reconnaissance assets and incompetency among parts of the Russian command staff. The milblogger complained that the Russian military command is not withdrawing units to the rear for rest and replenishment and to integrate new reinforcements, causing “erosion” within Russia's experienced units.

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-january-16-2025

10,747 posted on 01/17/2025 1:24:25 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10707 | View Replies]

1,670 i.e. more than 1.15 Russians and Norks/min>


10,748 posted on 01/17/2025 1:28:06 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10708 | View Replies]

To: PIF
Кремлевская табакерка

17JAN2025: “It will be more difficult, but not critical.” The Central Bank changed its forecast for the dollar exchange rate and gave us some figures

Here, colleagues repeated our forecast that the dollar exchange rate will reach 120 rubles this year. A source in the Central Bank told us this figure back in late December and then talked about the first half of 2025. But the situation has changed since then.” It will be more difficult than we predicted then, but nothing critical. The dollar exchange rate this year will most likely reach a maximum of 130-135 rubles. There will be fluctuations up and down, of course, that is, the dollar will not always be worth that much. This is how the economic situation is developing. Please clarify the information so as not to mislead anyone,” said a source in the Central Bank. He specially contacted us to provide this data.

“The year will be difficult, but I hope without catastrophes. We're holding on!” the source added.

https://t.me/kremlin_secrets/5176

10,749 posted on 01/17/2025 2:15:21 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10729 | View Replies]

To: JonPreston

Trump recognises NATO expansionism triggered the war in Ukraine and blames Biden for the foolish decision

This is great news for peace. Trump moves away from the "unprovoked invasion" narrative that was used to prevent a peaceful settlement and legitimise a long war. pic.twitter.com/pVa6bATlon— Glenn Diesen (@Glenn_Diesen) January 10, 2025


10,750 posted on 01/17/2025 3:08:16 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10742 | View Replies]

To: JonPreston

10,751 posted on 01/17/2025 3:10:54 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10750 | View Replies]

To: BeauBo

All Norks, most of the time

Note: Reporting From Ukraine: 17 Jan: Extra Exclusive: Russia’s Armored Crisis: 3,600 Tanks Lost, only 250 New Produced in 2024 - Paid view only

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Putin Wants a Refund! North Koreans Are Losing Kursk!!! ]

Today [ Jan 16, 8 pm ], there are important updates from the Kursk direction.

Here, the elite Ukrainian special forces capitalized on their momentum and launched a decisive counterattack in the Kursk region near Kruglenkoe, targeting the exhausted North Korean troops in a forested area.

Benefitting from their superior skills and modern equipment, they dealt a decisive blow to the enemy before the North Koreans could consolidate control over this territory.

The Ukrainian aim was to neutralize the remaining North Korean troops, clear this sector of the frontline, and reclaim strategic positions near Kruglenkoe. This effort was critical in preventing the enemy from consolidating their foothold, and ensuring the frontline remained stable.

Ukrainian special forces capitalized further on their momentum from a successful tank raid on Nikolaevka, which we discussed in a previous report, so they launched the counterattack with the dual goal of eliminating enemy survivors and pushing the frontline back to Kruglenkoe. Reclaiming this area was essential to disrupt Russian plans for further offensives and to safeguard Ukrainian positions near Malaya Loknya.

Ukrainian special forces sought to exploit a moment of vulnerability after a series of disastrous North Korean assaults on Malaya Loknya, where the deployed enemy units had been left heavily depleted.

Because North Koreans fought almost until the last man was dead, these units suffered catastrophic losses, due to poor coordination and a near-total absence of fire support from Russian forces. Ukrainians Intelligence reports estimate approximately 4,000 North Korean casualties in the region, attributed to Russia’s neglect in providing adequate artillery and logistical support.

To achieve their objectives, Ukrainian operators relied on rapid assaults, backed by extensive fire support. Equipped with thermal scopes, these elite forces operated with unparalleled precision. Advanced technology allowed them to detect enemy positions as the North Korean soldiers were heavily contrasted against the cold and snowy background, which made the Ukrainians much more effective.

Coupled with superior preparation and coordination, these capabilities gave the Ukrainians a decisive edge over the North Korean troops, who lacked comparable equipment and modern training.

The Ukrainian forces also leveraged their logistical advantage. By operating from Malaya Loknya, they could resupply efficiently and minimize the risk of detection during troop movements, due to the short travel time. By striking swiftly and unexpectedly, they aimed to deny the North Koreans any opportunity to prepare or reinforce their defenses.

Despite their advantages, the Ukrainian soldiers faced significant challenges. The North Korean troops had already taken positions in forested areas and houses, which provided them with natural and structural cover against Ukrainian aerial reconnaissance and drone strikes.

Clearing such terrain required meticulous planning and could have exposed the Ukrainian special forces to ambushes. Additionally, the persistent risk of Russian reinforcements arriving to bolster the North Koreans, added a layer of urgency to the operation. Ukrainian forces had to act decisively before the enemy could regroup and launch further assaults.

The counterattack near Kruglenkoe began with camouflaged Ukrainian troops advancing into the forested area where North Korean soldiers were regrouping for an offensive. The Ukrainians opened fire, quickly neutralizing many of the enemy combatants. During the operation, they examined the bodies of fallen North Korean soldiers and discovered one survivor.

As they attempted to take him prisoner, the soldier pulled a grenade, shouted a defiant cry, and detonated it, killing himself in an act of desperation. A Ukrainian soldier narrowly avoided injury, jumping back just in time.

Following this operation, a 15-man Russian assault group was sent to locate the Ukrainian operators. However, their efforts proved futile as they were swiftly detected by Ukrainian drone units, who destroyed the enemy group with precision and efficiency.

Overall, the operation resulted in the elimination of more North Korean soldiers and the dismantling of their attempt to consolidate their positions, due to the superior training, equipment, and tactical execution of the Ukrainian special forces.

By eliminating the remnants of the North Korean contingent and reclaiming strategic positions near Kruglenkoe, Ukrainians have strengthened their defensive line and dealt a significant blow to enemy morale.

The high casualties among North Korean troops highlight the unsustainable nature of their deployment under Russian command, plagued by inadequate fire support and poor coordination, while underscoring the Ukrainian military’s ability to exploit enemy weaknesses.


10,752 posted on 01/17/2025 4:02:31 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10746 | View Replies]

To: BeauBo

We have reached the point where 🍈 is demonstrating WC Fields “If you can’t dazzle them with brilliance, baffle them with bullshit.”

And I agree with 🍈 about NATO expansion being a “triggering “ event. Putin’s dreams of a return to Soviet Union power and prestige was threatened by Ukraine joining NATO. Not that Russia was threatened by NATO expansion, but more that his dreams to expand Russia were. He knew that if Ukraine joined NATO that dream would become impossible, so he struck before that could happen.
The irony is that his actions caused the expansion of NATO with Sweden and Finland joining (something not even considered possible before his invasion), and the weakening of Russian power both militarily and economically.

Every day putin continues this madness the closer a 1917/1991 type event becomes more likely.

Almost three years into his plan for power and prestige, Putin has made Russia a shell both militarily and economically of what it was in 2022

The difference between then and now is that putin had a choice then, he does not now. A defeat of his ambitions is not a threat to Russia, but to him.
Live by the sword, die by the sword


10,753 posted on 01/17/2025 4:02:55 AM PST by blitz128
[ Post Reply | Private Reply | To 10746 | View Replies]

To: AdmSmith

“We’re holding on” is not exactly a positive😎🍈


10,754 posted on 01/17/2025 4:05:15 AM PST by blitz128
[ Post Reply | Private Reply | To 10749 | View Replies]

To: blitz128

We see that 🍈’s latest graphic come from India’s WION. World is One News. Always a reliable source for the latest inside information. /s


10,755 posted on 01/17/2025 4:09:02 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10745 | View Replies]

To: FtrPilot

The usuals like to talk of the age of Ukrainian fighters, this video does not paint a very strong picture of Russian forces.
Then again potato water does age people quickly.


10,756 posted on 01/17/2025 4:11:16 AM PST by blitz128
[ Post Reply | Private Reply | To 10727 | View Replies]

To: FtrPilot

PPP is an interesting metric.
How does 21%+ interest rates, 10+ inflation rate and much of your GDP being blown up factor into this?


10,757 posted on 01/17/2025 4:14:34 AM PST by blitz128
[ Post Reply | Private Reply | To 10728 | View Replies]

To: PIF

As Lennon not Lenin said “whatever gets you through the night “😎


10,758 posted on 01/17/2025 4:17:45 AM PST by blitz128
[ Post Reply | Private Reply | To 10755 | View Replies]

To: blitz128

As Lennon not Lenin said “whatever gets you through the night “

His nights are long and cold. Maybe they will turn on central heating, if he’s a good boy.


10,759 posted on 01/17/2025 4:21:07 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10758 | View Replies]

To: BeauBo
Russian Ship Sinking: Spy Ship Yantar Diving on Wreck
During the forenoon of January 15th, the Russian oceanographic research vessel Yantar arrived in a position 40 nautical miles north of Oran, Algeria, and 216 nautical miles east of Gibraltar.

This area corresponds with the location where on December 24th , the Russian cargo vessel MV Ursa Major sank after an alleged explosion in her engine room that might have taken place on December 23rd around 12:30 local time.

Rear Admiral Konovalov is known to be the commander of the 29th Special Purpose Submarine Brigade, a unit that operates special submersible craft for GUGI. The presence of such a high ranking military member on board of the Yantar is raising questions on what exactly the vessel is trying to investigate at the wreckage site of the MV Ursa Major. Whatever the reason is for Yantar to operate over the MV Ursa Major's wreckage, the issue appears to be important enough to have Rear Admiral Konovalov, be present on board of the Yantar to oversee the operations. The presence of such a high ranking officer suggest that Yantar’s operations are probably ordered high up in Russia's political decision making processes.

more text https://www.navalnews.com/naval-news/2025/01/russian-ship-sinking-spy-ship-yantar-diving-on-wreck/

10,760 posted on 01/17/2025 4:54:21 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10746 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 10,721-10,74010,741-10,76010,761-10,780 ... 22,161-22,169 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson