Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 10,341-10,36010,361-10,38010,381-10,400 ... 18,681-18,685 next last
To: PIF; ETCM; AdmSmith

Reports that Turkey (NATO) is looking to occupy Russia’s former Naval base at Tartus, Syria; as well as other bases in the country. Makes sense.

https://freerepublic.com/focus/f-news/4288295/posts

Putin is a Master Strategist.

What is next, Kaliningrad? BenGhazi?


10,361 posted on 01/06/2025 3:42:46 AM PST by BeauBo
[ Post Reply | Private Reply | To 10360 | View Replies]

To: BeauBo

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Ukrainians Unleash Tanks on Russian Troops Hiding in a Village ]

Today [ Jan 05, 8 pm ], there are a lot of interesting updates from the direction of Lyman.

Here, Russians continue their renewed assaults on Terny, trying to break the Ukrainian defenses through overwhelming artillery fire and large mechanized assaults.

However, Ukrainians have exposed a huge Russian weakness, allowing Ukrainian tank crews to eliminate the Russian assaults from point-blank range.

The Russian forces are launching a renewed mechanized effort south of Terny, aiming to secure a foothold for further advances in the Lyman direction. The Russian focus shifted to the southern part of Terny, after a series of repeated failed assaults on the northern part of the settlement, where Russian units suffered heavy losses without making practically any gains.

Russians are deploying numerous infantry fighting vehicles in large mechanized convoys to breach Ukrainian defenses east of Terny. These groups are meant to dismount a large number of Russian stormtroopers, who then take up positions in the houses and basements in the southern part of the village, gradually consolidating their control.

Once established, Russian forces could cut off Ukrainian supply and reinforcement routes to the north, placing key roads under fire control. This would render Ukrainian positions in northern Terny unsustainable, as they would be starved of ammunition and supplies.

If we take a look at the topographic map, we can see that the key Russian tactical advantage in this area is their control of the hills east of Terny. This elevated position provides a clear line of sight over Ukrainian positions and movements within the village, allowing Russian units to observe Ukrainian forces more effectively.

Additionally, the terrain shields Russian assault units from direct Ukrainian fire while on the move.

The northern elevations are under Russian control, and a forest blocks Ukrainian visibility from the south, while winding paths and hills obscure the view from within Terny. To support their assault, Russians have stockpiled artillery shells in the region, able to unleash heavy barrages as they try to break Ukrainian resistance.

However, despite their advantages, Russian mechanized units must traverse 20 km of open fields and along tree lines, to get from their nearest logistics hub in Kremmina to Ukrainian positions along the river. This journey takes Russians approximately 30-45 minutes, providing Ukrainian drone operators ample time to detect and track the advancing units, relaying the information for Ukrainian defenders to prepare.

In addition to exposing Russian assault forces to early detection and precision strikes, the significant distance, combined with the lack of hardened roads, makes it impossible for the Russians to adequately supply any bridgehead they establish in Terny.

Furthermore, the lack of a secure Russian supply line allowed the Ukrainians to easily eliminate any bridgeheads the Russians attempted to establish. As any Russian flanking attack would immediately be detected during the 20km journey across open fields, Ukrainians could even deploy their tanks in a direct fire role to eliminate any Russian stormtroopers with utmost aggression.

Combat footage from the area shows Ukrainian artillerymen effectively destroying the lead armored vehicle in a Russian column, causing the entire column to slow down and panic to spread among the Russian stormtroopers.

Over a dozen Russian soldiers started abandoning the vehicles, fleeing into the forest, while several BMP-2s and a portion of the units pressed on with the assault. Ultimately, only a single BMP-2 managed to survive and reach the southern part of Terny, where the Russian stormtroopers dismounted.

However, with prior intelligence about the assault, a Ukrainian tank crew was already on their way to target and eliminate the remaining Russian infantry in the southern part of Terny, as the footage shows them neutralizing the attackers and securing the village.

Overall, the renewed Russian assault towards Terny failed disastrously with most Russian soldiers being eliminated already before reaching the village. The Russian inability to solve their logistical issues will doom all of their assaults to failure, preventing any tactical gains through these tactics.

Terny remains a powerful Ukrainian stronghold that continues to repulse large Russian assault groups and drains Russian resources, as many of them have already met their end in the villages fields’.


10,362 posted on 01/06/2025 4:12:37 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10361 | View Replies]

To: BeauBo; PIF

10,363 posted on 01/06/2025 4:43:59 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10358 | View Replies]

To: AdmSmith; dennisw; PIF; BeauBo

Your post suggests that Americans should steal $300bn in Russian assists, give it to Zelensky so he can buy weapons from American manufactures? As a foreigner, who the hell are you to suggest such stupidity?


10,364 posted on 01/06/2025 5:05:16 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10363 | View Replies]

To: AdmSmith

It is a great idea to take assets from Russia - it is perhaps the most cost effective approach to achieve security from an aggressive and irredeemable mafia State, like Putin’s Russia.

Not just current/former assets, but also future income streams, especially oil and gas.

Putin has shown clearly the murderous use he will make of any surplus resources. It is dangerous malpractice to leave that sociopath with the means to make further war.

Russia must be bankrupted, for the good of humanity


10,365 posted on 01/06/2025 5:21:58 AM PST by BeauBo (Not)
[ Post Reply | Private Reply | To 10363 | View Replies]

To: BeauBo
It is a great idea to take assets from Russia

people like you would never actually take money from a Russian and give it to someone else, rather you support the American state stealing it and acting in your behalf. Some would call that rank cowardice.

10,366 posted on 01/06/2025 5:37:48 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10365 | View Replies]

To: JonPreston

Bad Vlad is worth 200 billion from all the cuts of the action that he gets, for oligarch owned businesses. Such as Gazprom. Putin is so rich, that he will never notice when Ukraine is handed over the Rooski 300 billion, frozen in European banks.


10,367 posted on 01/06/2025 6:01:42 AM PST by dennisw
[ Post Reply | Private Reply | To 10366 | View Replies]

To: AdmSmith

That way UKR can buy the latest US weapons tech if they chose. Let the whiners sulk and call out names which is just more of their useless prattle.


10,368 posted on 01/06/2025 6:09:29 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10363 | View Replies]

To: dennisw
Bad Vlad is worth 200 billion... he will never notice when Ukraine is handed over the Rooski 300 billion

It's funny how you over-vaxxed, cowardly Neocons stumble around in the dark searching for an American foreign policy, that has as its cornerstone perpetual war. It isn't our money Dimwit and it sure as hell isn't Zelensky's. Please tell US how handing the Greasy Green Shirt stolen money benefits American taxpayers?

10,369 posted on 01/06/2025 6:12:06 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10367 | View Replies]

To: dennisw

A certain person on this thread is fishing real hard for a confrontation - let him fish and suffer silence.


10,370 posted on 01/06/2025 6:38:41 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10367 | View Replies]

To: PIF; dennisw; BeauBo

British parliamentarians have written a letter calling on the government to develop a legal mechanism for transferring $300 billion of frozen reserves from Russia’s Central Bank to Ukraine, The Times reports.

The letter, which was sent to the Times, was signed by a dozen British MPs, as well as politicians from Germany, Poland, and the Baltic states. The authors of the letter believe that transferring at least 25.5 billion pounds ($3.19 billion) of the funds held in Britain’s account to Ukraine would send a clear signal of strategic resolve and help prevent future conflicts.

https://newsukraine.rbc.ua/news/british-mps-call-for-transfer-of-frozen-russian-1736168136.html


10,371 posted on 01/06/2025 7:16:54 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10370 | View Replies]

To: AdmSmith

Correction:

least 25.5 billion pounds ($31.19 billion)


10,372 posted on 01/06/2025 7:20:18 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10371 | View Replies]

To: PIF

Yes, thanks.


10,373 posted on 01/06/2025 7:21:58 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10372 | View Replies]

To: AdmSmith

“calling on the government to develop a legal mechanism for transferring $300 billion of frozen reserves from Russia’s Central Bank to Ukraine, The Times reports.”

Reparations for war crimes, and all the damages done by the whole illegal invasion - a trillion dollars.

Seize every Russian Government asset, every ship at sea, and any future account or cargo, until the debt is paid.

Perhaps we could even do what Russia has done, and seize the assets of Russian businesses as well.


10,374 posted on 01/06/2025 7:35:58 AM PST by BeauBo
[ Post Reply | Private Reply | To 10371 | View Replies]

To: dennisw

The only safe Putin, is a penniless Putin.

The only way bankrupt Putin, is to bankrupt Russia again.

Because of Putin.


10,375 posted on 01/06/2025 7:40:24 AM PST by BeauBo
[ Post Reply | Private Reply | To 10367 | View Replies]

To: PIF

🍈 must be lonely


10,376 posted on 01/06/2025 8:08:50 AM PST by blitz128
[ Post Reply | Private Reply | To 10370 | View Replies]

To: BeauBo

The latest in Empire vs Empire wars... Is that Erdoğan- Turkey will be taking over Rooski (former) bases in Syria. Erdoğan stabbing Putin in the back, again. Putin was counting on the arrangements and understandings he made with Erdoğan. But after Assad fell, Erdoğan went his own way. He made his moves, that he had to make.

The best part is that Putin (Russian Orthodox Tsar) feels he knows how to paternalistically control his rambunctious Muslims. Such as Iran, such as Chechens and the Muslims near Chechnya......... and Erdoğan.


10,377 posted on 01/06/2025 8:14:58 AM PST by dennisw
[ Post Reply | Private Reply | To 10375 | View Replies]

🚨 #BREAKING - JUSTIN TRUDEAU: "I intend to resign as [Liberal] Party leader, as Prime Minister [of Canada] after the party selects its next leader."

Replacement elections to happen in the near future.

"If I'm having to fight internal battles, I cannot be the best option." pic.twitter.com/HPAh6FJHlT— Eric Daugherty (@EricLDaugh) January 6, 2025


10,378 posted on 01/06/2025 8:16:15 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10369 | View Replies]

To: PIF; dennisw
A certain person on this thread is fishing real hard for a confrontation - let him fish and suffer silence.

Dimwit, has the Committee delivered their marching orders clearly enough? They want obedience and uniformity of thought. Don't color outside of their lines.

10,379 posted on 01/06/2025 8:20:03 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10370 | View Replies]

To: JonPreston; AdmSmith; dennisw; PIF; BeauBo

“Your post suggests that Americans should steal $300bn in Russian assists, give it to Zelensky”

Those are European/American/Ukraine spoils of war. Putin is well versed in spoils of war. Rooski invaders troops know their spoils system too, heisting washing machines, microwaves and lots more from Ukrainian homes. To haul back to Rus.


10,380 posted on 01/06/2025 8:24:17 AM PST by dennisw
[ Post Reply | Private Reply | To 10364 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 10,341-10,36010,361-10,38010,381-10,400 ... 18,681-18,685 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson