Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 10,001-10,02010,021-10,04010,041-10,060 ... 20,261-20,277 next last
To: BroJoeK

I was trying to keep my version PG rated — could have gone with any number of spicier scenarios. 😉


The Spice must flow!!


10,021 posted on 12/28/2024 3:32:57 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10018 | View Replies]

To: BeauBo

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Putin is Furious. Confused North Koreans Kill The Wrong Enemy ]

Today [ Dec 27, 8 pm ], the biggest updates are coming from the Kursk direction.

Here, as North Korean assaults suffer disastrous losses with little to no results, Russian commanders turned to Chechen special forces to bolster their failing efforts. However, a critical language barrier led to a catastrophic misunderstanding, with North Korean troops mistakenly opening fire on their Chechen reinforcements, resulting in even more devastating losses and further unraveling the offensive.

The main Russian offensive effort remains to take control of Kruglenkoe and the surrounding forests to advance further on Malaya Loknya and cut off the northern part of the Ukrainian salient. To accomplish this objective, Russians started reinforcing the new batches of North Korean meat waves with Chechen special operators.

As you remember from a previous report, Ukrainians have devised a plan to counter the North Korean tactic of overwhelming the Ukrainian defenses through sheer numbers. Ukrainians start by pulling back from disadvantageous positions, allowing North Koreans to take them instead, before annihilating the position with artillery and cluster munitions, launching clean-up raids with special forces to clear out the remaining survivors.

To maximize the damage, Ukrainians are not only targeting North Korean concentrations in the forests, but also intensely destroy them as they move across the fields into the forests with FPV kamikaze drones. This prevents North Koreans from even reaching the forest, and undermines any significant buildup of forces, which the North Koreans desperately need to use their tactics of human wave assaults.

The footage shows that North Koreans still do not receive any armored support from their Russian allies, forcing them to continue moving through the open fields on foot, in full exposure to Ukrainian drone operators, which, by this time, are already heavily patrolling the fields along with any other entryway into the forest.

The lack of further progress prompted the Russian commanders to reinforce this axis with more experienced Chechen units.

However, recently the Institute for the Study of War, as well as the Ukrainian intelligence service, stated that North Koreans are facing significant coordination issues with Russians and Chechens, due to the language barrier between them, undermining their combined offensives.

This possibly explains the lack of Russian fire support for the North Korean assaults. While Russians have somewhat intensified their artillery and air bombardments on the Kruglenkoe section of the front, these strikes are almost never done in coordination with a North Korean assault, drastically decreasing both of their effectiveness.

Moreover, the Institute for the Study of War reported that a North Korean contingent in the Kursk direction had fired upon a deployed group of Chechen Akhmat special forces, mistaking them for Ukrainians.

Reportedly, the North Koreans had opened fire on the Chechen convoy, damaging and destroying several vehicles, and killing 8 of the Spetsnaz soldiers. This is not the only communication error that Russian soldiers have reported, as many stories of Russians being nearly killed by the on-edge North Koreans have become public.

The Institute for the Study of War states that the poor integration and ongoing communication issues will likely continue to cause friction between Russian and North Korean forces, in both their current and future military operations in the Kursk region.

Overall, the language barrier between Russian and North Korean forces has become the new biggest problem for the newfound military partnership on the ground, even leading to the controversial friendly fire incident between the North Koreans and Chechen Akhmat special forces.

The inability to coordinate their combined operations, has led to a lack of targeted armor and fire support for the North Korean attacks, severely undermining their effectiveness.

Ukrainians, therefore, are continuing to find innovative ways to exploit these blatant weaknesses, not only targeting North Koreans when they are bunched up in the forests, but also preventing them from bunching up in the first place, targeting any movement across the fields through drone strikes with surgical precision.


10,022 posted on 12/28/2024 3:34:32 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10005 | View Replies]

To: All
Latest total Russia-Ukraine War casualty estimates:

Ukrainian military casualties:

  1. 230,000 Ukrainians dead & seriously wounded enough not to return to active duty through December 2024, according to Pres. Zelensky

  2. 62,000 Ukrainian military deaths (implies ~250k total casualties), including non-combat as of December 2024, according to ULLosses project.

  3. 310,000 Ukrainians killed & wounded through October, 2024, according to a US government estimate

  4. 480,000 Ukrainians killed & wounded through September 2024, according to the Wall Street Journal

  5. 480,000 Ukrainians dead & wounded through November 2024, estimated by The Economist

  6. 1,000,000 Ukrainian casualties claimed by Russian MOD, December 2024
Russian military casualties:

  1. 170,000 Russian dead (implies ~680k total casualties) through December 2024, estimated by BBC and Mediazona

  2. 728,000 Russian dead & wounded through June 30, 2024, estimated by The Economist

  3. 200,000 Russian dead (implies ~800k casualties) through December 2024, estimated by the BBC News Russia.

  4. 800,000 Russians killed (200k) & wounded (600k) through December 2024, according to Ukrainian military sources
Officers and Ukrainian civilians:

  1. 4,500 Russian officers and 4,600 Ukrainian officers dead as of December 2024, according to Mediazona and UALosses

  2. 55,000 Ukrainian civilians killed, wounded or captured through November 2024, according to UN and Ukrainian estimates.

10,023 posted on 12/28/2024 3:43:06 AM PST by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 10012 | View Replies]

To: BroJoeK
At least 5 256 Russian officers have been eliminated in the Russian invasion of Ukraine since 24 February 2022.
Weekly update: +41 newly registered.
This figure is confirmed by Russian obituaries, graves and memorial plaques. Sources can be found in our spreadsheet.

https://x.com/KilledInUkraine/status/1870793536418824511

10,024 posted on 12/28/2024 3:50:07 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10023 | View Replies]

To: ansel12

Tomato - Tomato
Yes they are soldiers, but they are acting as mercs in the sense that Kim is being paid to send his Troops.

All fine in love and war….
Puts an exclamation point on what the usuals were saying at the beginning of the war er ah SMO that Russia is self sufficient and didn’t need any help particularly when it comes to men and materiel 😎


10,025 posted on 12/28/2024 4:13:54 AM PST by blitz128
[ Post Reply | Private Reply | To 10011 | View Replies]

To: All
Wasteful spending on “Orwellian cat experiments” and more highlighted in annual Festivus report.

"Senator Rand Paul releases his 2024 Festivus report on wasteful government spending"

Typically for the US State Department, the $4.8 million was spent to teach basics of journalism to Ukrainian media personalities.
10,026 posted on 12/28/2024 4:20:03 AM PST by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 10012 | View Replies]

To: ansel12

Additionally I would observe that Russia has gone to great lengths to condemn western weapons used by Ukraine and esp western weapons used on Russia proper(curious how weapons used on “annexed” portions of Ukraine are not treated the same), yet weapons supplied by Iran and North Korea have been used against Ukraine for some time. Guess that is okay

Lastly tell me if a “red line” has been crossed by NK troops being used to fight Ukrainians in Russia, and therefore the door is now open for NATO troops to be used on the front lines?

Would seem so


10,027 posted on 12/28/2024 4:22:34 AM PST by blitz128
[ Post Reply | Private Reply | To 10011 | View Replies]

To: PIF
Three captains of the Russian army were killed in a HIMARS strike

🕵️‍♂️ Directorate of Intelligence of Ukraine obtained information about a planned meeting with the participation of officers of the command of the 4th Guards Military Base of the Russian occupation forces, who are participating in the criminal war against Ukraine in the Zaporizhia region.

👥 As a result of the operation, three officers of the Russian occupation forces were eliminated:

☠️ Captain Nagorny Dmitry Olegovich, commander of the 1st battalion of the 135th motorized rifle regiment of the Armed Forces of the Russian Federation;

☠️ Captain Krokhmalov Grigory Aleksandrovich, deputy chief of staff for intelligence, chief of intelligence of the 135th motorized rifle regiment of the Armed Forces of the Russian Federation;

☠️Captain Fomin Yuri Viktorovich, commander of the anti-aircraft battery of the 4th Guards Military Base of the Armed Forces of the Russian Federation.

✔️ As a result of a successful operation by the Department of Active Operations of the Main Intelligence Directorate of the Ministry of Defense of Ukraine, the Security Service of Ukraine, the Unmanned Systems Forces of the Armed Forces of Ukraine and the operational group of troops “Tavria”.

https://x.com/bayraktar_1love/status/1872569968144810234


10,028 posted on 12/28/2024 4:25:21 AM PST by FtrPilot
[ Post Reply | Private Reply | To 10022 | View Replies]

To: PIF

“North Korean assaults suffer disastrous losses with little to no results”

Kyiv Independent reports:

North Korean troops suffer over 1,000 losses in Kursk Oblast in past week, White House official says

“North Korean troops are experiencing mass casualties while fighting alongside Russian forces against Ukraine in Kursk Oblast, White House National Security Council spokesperson John Kirby said on Dec. 27.

The comments come a day after Ukraine’s military intelligence agency (HUR) on Dec. 26 reported that North Korean troops had suffered heavy losses in Kursk Oblast.

The White House believes more than 1,000 North Korean troops have been killed or wounded over the past week alone, Kirby said in a press briefing.

“It is clear that Russian and North Korean military leaders are treating these troops as expendable and ordering them on hopeless assaults against Ukrainian defenses,” he said.“


10,029 posted on 12/28/2024 4:25:43 AM PST by BeauBo
[ Post Reply | Private Reply | To 10022 | View Replies]

To: AdmSmith
"At least 5 256 Russian officers have been eliminated"

Thanks for the update!

10,030 posted on 12/28/2024 4:32:12 AM PST by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 10024 | View Replies]

To: blitz128

It isn’t tomato -tomato, mercenary is an actual category of an individual fighting for hire, and he falls under a different category in international rules of war.

Russia uses mercenaries and Wagner is an example of that but the North Koreans are regular army troops whose legal status is as a legal state soldier.

You have read many times that Russia is going to treat Ukraine foreign volunteers as mercenaries but they can’t do that legally because all of them are part of the Ukraine armed forces which means their legal status is that of a regular Ukraine soldier, well the Norks are soldiers as well, they are not mercenaries.


10,031 posted on 12/28/2024 5:10:31 AM PST by ansel12 ((NATO warrior under Reagan, and RA under Nixon, bemoaning the pro-Russians from Vietnam to Ukraine.))
[ Post Reply | Private Reply | To 10025 | View Replies]

To: blitz128

“””Lastly tell me if a “red line” has been crossed by NK troops being used to fight Ukrainians in Russia, and therefore the door is now open for NATO troops to be used on the front lines?”””

I don’t even know what that means, what red line and what door would have to be opened?


10,032 posted on 12/28/2024 5:13:19 AM PST by ansel12 ((NATO warrior under Reagan, and RA under Nixon, bemoaning the pro-Russians from Vietnam to Ukraine.))
[ Post Reply | Private Reply | To 10027 | View Replies]

To: ansel12

Kim and Putin signed a defense treaty. If any nation attacks the other—the treaty pops in and the other signer must send help. Because Ukraine invaded Russia Proper at Kursk and occupied the place, it kicks in, as it would if South Korea invaded and held a piece of North Korea. It doesn’t apply to Ukraine Proper of disputed lands. If Ukraine pulls out of Kursk—The North Koreans would go home. Kim wants Russian good will, oil, gas, and grains. So far he has gotten what he wants. What did it cost him? a few hundred lives.


10,033 posted on 12/28/2024 5:35:47 AM PST by Forward the Light Brigade (. War is Hell, War IS a Crime.)
[ Post Reply | Private Reply | To 10032 | View Replies]

To: blitz128
Lastly tell me if a “red line” has been crossed by NK troops being used to fight Ukrainians in Russia

Please show us evidence of these NK troops.

10,034 posted on 12/28/2024 5:46:48 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 10027 | View Replies]

To: Forward the Light Brigade

It’s nice that you have a theory.


10,035 posted on 12/28/2024 5:55:29 AM PST by ansel12 ((NATO warrior under Reagan, and RA under Nixon, bemoaning the pro-Russians from Vietnam to Ukraine.))
[ Post Reply | Private Reply | To 10033 | View Replies]

To: BeauBo

U.S. Army’s First Combat Use Of THAAD Missile Defense System Just Occurred In Israel
An official confirmed that the interceptor was fired at a Houthi ballistic missile Thursday night over Israel.
https://www.twz.com/land/u-s-armys-first-combat-use-of-thaad-missile-defense-system-just-occurred-in-israel


Russian-Linked Oil Tanker Suspected Of Sabotage Was Brimming With Spy Equipment: Report
The Eagle S is suspected of severing the Estlink 2 power cable running under the Baltic Sea between Finland and Estonia.
https://www.twz.com/sea/russian-linked-oil-tanker-suspected-of-sabotage-brimming-with-surveillance-equipment-report


10,036 posted on 12/28/2024 6:05:30 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10029 | View Replies]

To: ansel12

Distinction without a difference
Legally yes reality no
Putin has paid for the NK to be there

Tomato- Tomato


10,037 posted on 12/28/2024 6:34:48 AM PST by blitz128
[ Post Reply | Private Reply | To 10031 | View Replies]

To: Forward the Light Brigade

Ukraine attacked Kursk in august. Russia and NK signed pact in November
The treaty does allow for NK troops as you said, and that is fine. Just seem to remember usuals saying Russia didn’t need any help….

As to leaving or not fighting(Jon boy disagrees with you on that, says he needs proof😂), if Ukraine leaves Kursk, have my doubts.

Besides Russia needing the bodies, the 4 oblasts that Russia annexed “are” part of Russia according to putin, so NKs aren’t going home

As you inferred, win-win for Kim and Putin


10,038 posted on 12/28/2024 6:43:57 AM PST by blitz128
[ Post Reply | Private Reply | To 10033 | View Replies]

To: blitz128

LOL, why you want to be so wrong is baffling, this is another example of a word being made meaningless, what are we going to call mercenaries now if the word is being stolen to describe normal and legal soldiers?

If you are captured you would sure want for the correct classification to be used, quit making up things because you think they sound sexier, the official North Korean Army is the conflict, just as would be American troops or Polish, or any other nation’s troops.


10,039 posted on 12/28/2024 6:44:46 AM PST by ansel12 ((NATO warrior under Reagan, and RA under Nixon, bemoaning the pro-Russians from Vietnam to Ukraine.))
[ Post Reply | Private Reply | To 10037 | View Replies]

To: FtrPilot

Also see:
Putin’s army reeling as deadly Ukraine missile strike ‘wipes out key Kursk command post’
https://freerepublic.com/focus/f-chat/4286823/posts

or

https://www.express.co.uk/news/world/1993223/putin-army-810-marines-command-post-kursk-hit-ukraine-war/amp


10,040 posted on 12/28/2024 6:47:31 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 10028 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 10,001-10,02010,021-10,04010,041-10,060 ... 20,261-20,277 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson