Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

The invincible tardigrade — already a weird animal — is full of DNA stolen from bacteria
wapo ^ | November 25 at 10:39 AM | Rachel Feltman

Posted on 11/25/2015 9:32:36 PM PST by BenLurkin

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-4041-57 last
To: Pelham

You have no idea.

;D


41 posted on 12/05/2015 10:03:20 PM PST by Salamander (Can't sleep. The clowns will eat me...)
[ Post Reply | Private Reply | To 40 | View Replies]

To: BenLurkin; Salamander; SunkenCiv
Like every other living thing, this little creature can fall victim to merciless parasites.

Read the horror story here:
http://dailyparasite.blogspot.se/2014/08/ballocephala-sphaerospora.html

and the result:



Illustration by Lizzie Harper of Ballocephala sphaerospora that has infected a tardigrade.

42 posted on 12/06/2015 10:52:24 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

Nooooooo!

Poor little guys!

:(


43 posted on 12/06/2015 11:58:00 AM PST by Salamander (Can't sleep. The clowns will eat me...)
[ Post Reply | Private Reply | To 42 | View Replies]

To: Salamander

Agree, but if you look at the site http://dailyparasite.blogspot.se/ you can find the weirdest parasites.


44 posted on 12/06/2015 12:15:14 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 43 | View Replies]

To: SunkenCiv

This is sooo obviously The Thing in larval form but is anyone connecting the dots?!!? Nope. Not even trying.

It’s like a global conspiracy to get those guys at the Antarctic station slaughtered.


45 posted on 12/06/2015 12:16:27 PM PST by Grimmy (equivocation is but the first step along the road to capitulation)
[ Post Reply | Private Reply | To 37 | View Replies]

To: BenLurkin


46 posted on 12/06/2015 12:20:33 PM PST by JoeProBono (SOME IMAGES MAY BE DISTURBING ’VIEWER DISCRETION IS ADVISED;-{)
[ Post Reply | Private Reply | To 1 | View Replies]

To: JoeProBono; BenLurkin; Salamander; SunkenCiv

Researchers have successfully revived microscopic creatures that had been kept frozen for 30 years.

Scientists at at Japan’s National Institute of Polar Research retrieved the creatures from a frozen moss sample collected in Antarctica in 1983. The sample had been stored at -20 C for just over three decades.

The previous survival record for adult tardigrades under frozen conditions was eight years, and a much earlier study had suggested that the upper limit for survival under normal atmospheric oxygen conditions was about 10 years.

http://www.telegraph.co.uk/news/science/12102714/Animal-brought-back-to-life-after-spending-30-years-frozen.html


47 posted on 01/16/2016 12:10:32 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 46 | View Replies]

To: AdmSmith; Daffynition


48 posted on 01/16/2016 12:36:33 PM PST by JoeProBono (SOME IMAGES MAY BE DISTURBING ’VIEWER DISCRETION IS ADVISED;-{)
[ Post Reply | Private Reply | To 47 | View Replies]

To: AdmSmith; AnonymousConservative; Berosus; bigheadfred; Bockscar; cardinal4; ColdOne; ...

Figures, the Tardigrave is that time travel box Dr Who uses... wait, what?


49 posted on 01/16/2016 1:12:47 PM PST by SunkenCiv (Here's to the day the forensics people scrape what's left of Putin off the ceiling of his limo.)
[ Post Reply | Private Reply | To 47 | View Replies]

To: JoeProBono
Stop your microagression!


50 posted on 01/16/2016 2:52:44 PM PST by Daffynition (*Security, confiscate their coats. Get them out of here. It's 10 below zero out there ~DJT)
[ Post Reply | Private Reply | To 48 | View Replies]

To: Salamander

Deviant! :)


51 posted on 01/16/2016 2:56:31 PM PST by Daffynition (*Security, confiscate their coats. Get them out of here. It's 10 below zero out there ~DJT)
[ Post Reply | Private Reply | To 22 | View Replies]

To: Daffynition

Love ‘em madly!


52 posted on 01/16/2016 4:40:53 PM PST by Salamander (I made friends with a lot of people in the danger zone...)
[ Post Reply | Private Reply | To 51 | View Replies]

To: Salamander
Your DNA test proves...YOU'RE NOT THE MOTHER...or THE FATHER!!


53 posted on 01/16/2016 5:55:05 PM PST by Daffynition (*Security, confiscate their coats. Get them out of here. It's 10 below zero out there ~DJT)
[ Post Reply | Private Reply | To 52 | View Replies]

To: Salamander; Daffynition
After consulting with my Mongolian Shaman, Genghis Gurragchaa...

...he has informed me that the Tardigrade is my second alternate Spirit Animal.

This will greatly augment my quest for Enlightenment as my primary Spirit Animal, the Giant, Three-toed Arboreal Sloth was taking his own sweet time seeking transcendence.

54 posted on 01/17/2016 8:50:17 AM PST by shibumi (Vampire Outlaw of the Milky Way)
[ Post Reply | Private Reply | To 52 | View Replies]

To: BenLurkin

Not so tough after all.

....a living tardigrade that's not in the cryptobiotic state is actually pretty fragile.
If you stuck a living, active tardigrade directly into liquid nitrogen, boiling water, your own stomach acid, etc. etc., you'd kill it instantly.
Your own immune defenses would make short work of any tardigrade that got into your bloodstream.
Tardigrades can get attacked by viruses and bacteria and fungi and predatory nematodes, and they can be physically damaged as well.
There are lots of things that can kill them.





55 posted on 01/17/2016 9:10:22 AM PST by Koracan
[ Post Reply | Private Reply | To 1 | View Replies]

To: Koracan

Buzz kill.


56 posted on 01/17/2016 10:05:24 AM PST by Salamander (I made friends with a lot of people in the danger zone...)
[ Post Reply | Private Reply | To 55 | View Replies]

To: shibumi
Sorry, I'm *Tardy to the Party* ...oh yeah! ;(


57 posted on 01/17/2016 4:51:16 PM PST by Daffynition (*Security, confiscate their coats. Get them out of here. It's 10 below zero out there ~DJT)
[ Post Reply | Private Reply | To 54 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-57 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson