Free Republic
Browse · Search
News/Activism
Topics · Post Article

To: catnipman

I asked my son, who has a PHD in Microbiology (focus on genetic engineering) about the idea that this is a man-made virus. this is his response:

Dad,

Long story short: This is outside my wheelhouse, but what I see doesn’t convince me of much.

The relevant publication (at-least one of them) might be: https://www.biorxiv.org/content/10.1101/2020.01.30.927871v1.full.pdf

The paper claims that there are a few dozen genomic sequences from the current virus on NCBI: https://www.ncbi.nlm.nih.gov/

Indeed, such files are available: https://www.ncbi.nlm.nih.gov/genome/genomes/86693?

I pulled all of the spike glycoprotein sequences:
https://www.ncbi.nlm.nih.gov/protein/QHN73795.1
https://www.ncbi.nlm.nih.gov/protein/QHN73810.1
https://www.ncbi.nlm.nih.gov/protein/QHO60594.1
https://www.ncbi.nlm.nih.gov/protein/QHO62877.1
They all appeared to be identical.

I used a portion of the protein sequence in a ProteinBlast (https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE=Proteins), which indicated that it was closely related to other known coronaviruses (e.g. SARS, and a bat coronavirus).

I then retrieved one version of the HIV GAG sequence (https://www.ncbi.nlm.nih.gov/protein/AAD39400.1), and attempted to align it with each of the spike glycoprotein sequences with SIM Align (https://web.expasy.org/sim/). This allignement didn’t show an impressive degree of similarity.

I tried the same thing with GP120 (https://www.ncbi.nlm.nih.gov/protein/NP_579894.2), which was similarly unimpressive.

I’m not sure how much similarity we’re expecting, but there are only a few residues in a row that are ever identical. The degree of similarity may be a fluke, or it may be statistically significant, but it’s far from the case that 2019-nCoV has been convincingly spliced together from HIV.

It might be more-impressive if there was overlap in the DNA sequences of 2019-nCoV and HIV. So, I pulled the actual genomic sequence for both an ran another allignment, this time with Clustal Omega. The results may be available here: https://www.ebi.ac.uk/Tools/services/web/toolresult.ebi?jobId=clustalo-I20200131-215248-0865-94258030-p2m

That actually shows some more -interesting stuff... HIV is a lot smaller than 2019-nCoV, so most of the genomes don’t overlap. The program is able to generate some weak overlap for virtually all of the HIV genome, but there’s a 1-in-4 that any given base pair can be matched, so that’s not a surprise. The odd thing is that there are some portions of the HIV genome that fail to allign at all to 2019-nCoV. It’s probably just a statistical anomaly.

If someone wanted to make some sort of hybrid HIV/Coronavirus, they went to great pains to make it subtle in 2019-nCoV.


59 posted on 02/01/2020 5:16:15 AM PST by LuigiBonnafini
[ Post Reply | Private Reply | To 1 | View Replies ]


To: LuigiBonnafini

Thanks! Good to know!


66 posted on 02/01/2020 5:46:21 AM PST by null and void (The government wants to disarm us after 243 yrs 'cuz they plan to do things we would shoot them for!)
[ Post Reply | Private Reply | To 59 | View Replies ]

To: LuigiBonnafini
Agree, and that is what was posted here https://www.freerepublic.com/focus/news/3811884/posts?page=15#15 but conspiracy theories are more interesting for the general public.

However, real life is even more fascinating, and sometimes frightening.

68 posted on 02/01/2020 5:55:49 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 59 | View Replies ]

To: LuigiBonnafini

The 3D model is much more convincing.

3 of the inserted regions appear to be conserved on the same ‘finger’ of the spike protein. They aren’t randomly distributed throughout. Which would make sense, even IF this was a natural occurrence.

I find it unlikely, myself, that 4 inserted regions (from any other source, not just HIV-1) of the length involved here (not the 5aa one poster insinuated, more like 8 or 10aa) would simultaneously result in a gain of function mutant. Things work the other way, generally. Ie, significant insertion/SNP breaks the thing altogether. (see sickle cell).


70 posted on 02/01/2020 6:02:48 AM PST by Black Agnes
[ Post Reply | Private Reply | To 59 | View Replies ]

To: LuigiBonnafini

Thank you also for posting that. It also debunks that junk science in the article. Just finding an “uncanny” resemblance is not proof of anything as your son’s report shows. Random recombination of the RNA can account for such “uncanny” similarity resemblances. That does not justify jumping to conclusions about viral engineering of weaponized biowarfare.


85 posted on 02/01/2020 6:40:14 AM PST by Swordmaker (My pistol self-identifies as an iPad, so you must accept it in gun-free zones, you hoplophobe bigot!)
[ Post Reply | Private Reply | To 59 | View Replies ]

To: LuigiBonnafini
If someone wanted to make some sort of hybrid HIV/Coronavirus, they went to great pains to make it subtle in 2019-nCoV.

I am reminded of 3M and POST-IT NOTES.

They were trying to make a 'super' glue. One of the failures was a glue that didn't stick very well at all. It went on to become one of 3M's most popular adhesive products.

It is possible that this virus was a product of the same process. None of the complex engineered mutations worked, but one batch showed a unique combination of what are normally natural mutations.

129 posted on 02/01/2020 8:02:57 AM PST by UCANSEE2 (Lost my tagline on Flight MH370. Sorry for the inconvenience.)
[ Post Reply | Private Reply | To 59 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson