Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

[N. Korea] NK claims successful launch of new ballistic missile
Korea Herald ^ | 2017-05-15

Posted on 05/14/2017 4:15:41 PM PDT by TigerLikesRooster

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-4041-53 next last
To: Daniel Ramsey

FatBoy Norker has proven that he has the limited ability with allies willing to help to improve such capability (Pakistan, Iran, Russia, China). Furthermore, the wherewithal and nuts to threaten the US is beyond the pale. Even the Soviets in their insane Cold War days knew reason and MAD. This is not a matter to underestimate this madman. Sneak a missile on a container ship and sneak into a major American harbor and there is zero defense and instant mass murder and destruction.


21 posted on 05/14/2017 5:27:36 PM PDT by shanover (...To disarm the people is the best and most effectual way to enslave them.-S.Adams)
[ Post Reply | Private Reply | To 17 | View Replies]

To: davidb56

You’re welcome to your opinion. I disagree.

The U.S. being present in all three places made it very clear that if someone tried anything, the U.S. would be immediately involved. It made it clear the decision to go against the local nation would men a declaration of war against the U.S.

We faced on world war in 1917 and another twenty years later.

We have had relative peace for 60 to 70 years in those locations.

That’s quite good considering.

During that time we have spent far far less than we would have if we had been involved in a WWIII by now, and the last time we left Germany unattended, look what happened.


22 posted on 05/14/2017 5:31:02 PM PDT by DoughtyOne (Happy days are here again!)
[ Post Reply | Private Reply | To 20 | View Replies]

To: Tea Party Terrorist

Why are our troops in South Korea, 50 plus years after the fact?

****************

Good question. Seems we get involved and never get out. Remember Sputnik was launched
October 4, 1957 by the Soviet and things have changed drastically over the last 60 years.


23 posted on 05/14/2017 5:31:31 PM PDT by deport
[ Post Reply | Private Reply | To 4 | View Replies]

To: Tea Party Terrorist
The South Koreans more than capable of their own defense.

As were the South Vietnamese in 1975. Fighting and dying for their freedom is not in their DNA.

24 posted on 05/14/2017 5:48:13 PM PDT by Karl Spooner
[ Post Reply | Private Reply | To 4 | View Replies]

To: davidb56
"IT only traveled 420 miles..."

...and reached an altitude of about 1320 miles. Funny shot, huh? It's probably more of an immediate concern for Japan, South Korea and the Philippines, though.


25 posted on 05/14/2017 5:49:00 PM PDT by familyop ("Welcome to Costco. I love you." --Costco greeter in the movie, "Idiocracy")
[ Post Reply | Private Reply | To 16 | View Replies]

To: TigerLikesRooster
Getting damn worried that we do not really have a way to stop ballistic missiles. Why do we not shoot these test firings in the air. Is it because we do not have the capability? That is very strange.
26 posted on 05/14/2017 5:49:15 PM PDT by Logical me
[ Post Reply | Private Reply | To 1 | View Replies]

To: TigerLikesRooster

It will be interesting to see the effects of North Korea’s actions on South Korean politics.


27 posted on 05/14/2017 5:52:59 PM PDT by familyop ("Welcome to Costco. I love you." --Costco greeter in the movie, "Idiocracy")
[ Post Reply | Private Reply | To 1 | View Replies]

To: Daniel Ramsey
"Yes, but look at how high it went first.Higher than the space station"

It flew over 1000 miles higher in altitude than the ISS. That means it had to do a re-entry burn to land that close to it's launch location. Don't forget, the NORKs put a satellite over Superbowl 50 within an hour of the end of the game. It's still up there. Just do a simple internet search and you can see the live track. Those that poo-poo this threat do so at their own peril.
28 posted on 05/14/2017 5:55:56 PM PDT by DocRock (And now is the time to fight! Peter Muhlenberg)
[ Post Reply | Private Reply | To 17 | View Replies]

To: DocRock

Sane observations, my friend. Very good.


29 posted on 05/14/2017 6:12:53 PM PDT by AmericanInTokyo
[ Post Reply | Private Reply | To 28 | View Replies]

To: DocRock

http://www.n2yo.com/satellite/?s=41332

SS1


30 posted on 05/14/2017 6:51:52 PM PDT by Spitzensparkin1 (Arrest and deport illegal aliens. Americans demand those jobs back! MAGA!)
[ Post Reply | Private Reply | To 28 | View Replies]

To: Karl Spooner

South Koreans fought with us in Vietnam (as did Australia and a few other allies). ROK units were very effective, particularly the ROK Marines. In one instance, they took over ground defense for an American airbase that had come under frequent rocket and sapper attacks from the Viet Cong and North Vietnamese.

While the U.S. unit that previously handled the task stayed close to the base, the ROK Marines launched an aggressive patrolling campaign over a wide area to find and engage the enemy. When they killed some ranking VC, they hung their bodies from trees and put up signs announcing they were now in charge of security in that area. Attacks on the base dropped dramatically in a matter of days.


31 posted on 05/14/2017 6:55:32 PM PDT by ExNewsExSpook
[ Post Reply | Private Reply | To 24 | View Replies]

To: DocRock

While i had minimal faith during the Obama invasion i have much more optimision now with Trump in charge, thank the Heavenly Lord Hillary lost the election.
If something is going to happen it should be in this next week. Hopefully.


32 posted on 05/14/2017 6:55:51 PM PDT by Daniel Ramsey (Thank YOU President Trump, finally we can do what America does best, to be the best!)
[ Post Reply | Private Reply | To 28 | View Replies]

To: TigerLikesRooster

You don’t negotiate with terrorists. Don’t see why the same doesn’t go for Fat Boy.


33 posted on 05/14/2017 6:56:57 PM PDT by BostonNeocon
[ Post Reply | Private Reply | To 1 | View Replies]

To: Daniel Ramsey

I agree...

Why would a missile go over 2000 km up, but less than 500 km down range???

(Space shuttle used to cruise at around 500 km)


34 posted on 05/14/2017 7:17:06 PM PDT by HippyLoggerBiker (Always carry a flagon of whiskey in case of snakebite and furthermore always carry a small snake.)
[ Post Reply | Private Reply | To 17 | View Replies]

To: HippyLoggerBiker

Probably a test for weight, might have had a concrete dummy payload to mimic their latest nuclear warhead, if they can get the altitude then all they need now is to adjust the trajectory, and extend it. This is it, now they know just how much more boost it requires to extend its range.

The next test i don’t think will be a test, it will be a live warhead, though they might detonate it out in the mid pacific, my guess is between Hawaii and the mainland.Or just south of the Aleutians.


35 posted on 05/14/2017 7:31:03 PM PDT by Daniel Ramsey (Thank YOU President Trump, finally we can do what America does best, to be the best!)
[ Post Reply | Private Reply | To 34 | View Replies]

To: Daniel Ramsey

Thanks for your reply.

But 2,000 Km in altitude? I have a hard time believing that would fall down less than 500 Km down range. Boy, talk about “Straight up, straight down”.


36 posted on 05/14/2017 7:50:24 PM PDT by HippyLoggerBiker (Always carry a flagon of whiskey in case of snakebite and furthermore always carry a small snake.)
[ Post Reply | Private Reply | To 35 | View Replies]

To: TigerLikesRooster
.....This is what Fat Boys Insanity looks like.....the sooner they get this creature out of the way the better....


37 posted on 05/14/2017 9:41:12 PM PDT by caww
[ Post Reply | Private Reply | To 1 | View Replies]

To: Spitzensparkin1

Very interesting....


38 posted on 05/14/2017 9:48:05 PM PDT by caww
[ Post Reply | Private Reply | To 30 | View Replies]

To: DocRock

...”Those that poo-poo this threat do so at their own peril”...

Unfortunately too few have a finger on the Worlds danger overall. Kim is even crazier than his father was..and those surrounding him are not about to hand over their comfy lifestyles without a fight and showing what they will do if anyone tries to disturb them in their country.

Then you have Russia, Iran, China and all their other ‘friends’ lending them a hand for their own purposes in that region.


39 posted on 05/14/2017 9:59:02 PM PDT by caww
[ Post Reply | Private Reply | To 28 | View Replies]

To: caww; TigerLikesRooster

Consider the number of pressure points Washington and Beijing share these days: tensions in the East China Sea that involve U.S. ally Japan, the question of arms sales to Taiwan and its future status, the South China Sea and now bilateral trade issues. China could easily demand America back down in one of these areas, much to the peril of Washington and its various allies.

For example, let’s say the Trump administration decided to give China a free ride in the South China Sea, one of the world’s most vital shipping lanes and the beating economic heart of Asia. Beijing would be able to cast aside the fishing, natural resource, and legitimate maritime rights of nations like Vietnam, the Philippines, Indonesia, Malaysia, and any other nation that stood in its way. Beijing would have control of not only Asia’s most vital waterway, through which 60 percent of Japan’s oil imports transit, but could economically strangulate almost any nation in the Asia-Pacific region. Would any nation in Asia ever see America the same again?

http://theweek.com/articles/697511/astronomical-cost-asking-china-restrain-north-korea


40 posted on 05/15/2017 3:22:53 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 39 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-53 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson