Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

[Exclusive] N. Korean General Defects Seeking Political Asylum (took $40m with him)
KBS (S. Korea) ^ | 2016-07-29

Posted on 07/31/2016 12:14:53 AM PDT by TigerLikesRooster

[Exclusive] N. Korean General Defects Seeking Political Asylum

Write : 2016-07-29 08:54:16 Update : 2016-07-29 14:15:08

Anchor: A general who was in charge of managing North Korean leader Kim Jong-un's overseas slush funds is said to be in China after escaping from his country, and is seeking political asylum with two other North Koreans in a country other than South Korea. A source said that the three were separated from a diplomat from Pyongyang, who is seeking his own defection to another country. Here is Kim Bum-soo with KBS' exclusive report.

Report: It has been made known that a general escaped from North Korea and is seeking political asylum in a country other than South Korea.

A source in China, who works in collaboration with Seoul government officials, on Thursday revealed the recent defection of the general, a diplomat and two others.

The source said that the North Korean military officer was in charge of managing Kim Jong-un’s slush funds in Southeast Asia.

The general was in China on a business trip when he was joined by the three other North Koreans on July 12th.

The diplomat is known to have parted ways with the group and is seeking political asylum in a country other than South Korea, while the other three are staying in China, making their own plans to defect to another country.

The latest escape marks the first known case of a North Korean general's defection from the reclusive regime. Last year, a North Korean colonel defected to the South.

The source said the four didn't choose to defect to South Korea partly because of a petition by the Lawyers for a Democratic Society filed last month for habeas corpus relief of 12 North Korean restaurant workers in China who defected to Seoul in April.

The source said that the four North Koreans decided to leave their country due to their dissatisfaction with the Kim Jong-un regime and pessimistic views about the future of the country. Kim Bum-soo, KBS World Radio News.


TOPICS: Foreign Affairs; Front Page News; News/Current Events
KEYWORDS: china; defection; general; nkorea
Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-8081-100 next last
To: thesligoduffyflynns
Not much else has been known except what I already mentioned.
61 posted on 07/31/2016 4:18:26 AM PDT by TigerLikesRooster (alt.current-events.clinton.whitewater)
[ Post Reply | Private Reply | To 59 | View Replies]

To: stuck_in_new_orleans
How does one take $40M with them?

"Tens and twenties!"


62 posted on 07/31/2016 4:24:58 AM PDT by COBOL2Java (Donald Trump, warts and all, is not a public enemy. The Golems in the GOP are stasis and apathy)
[ Post Reply | Private Reply | To 7 | View Replies]

To: stuck_in_new_orleans
How does one take $40M with them?

There's this group of Nigerians who keep sending me emails to move this kind of money...

I hope I'm not breaking the law by assisting them, they seemed so desperate .../h

63 posted on 07/31/2016 4:30:43 AM PDT by IllumiNaughtyByNature (HTTP 500 - Internal Server Error)
[ Post Reply | Private Reply | To 7 | View Replies]

To: IllumiNaughtyByNature
LOL! There are a few funny threads with anti-scammers, this is a nice one http://www.ebolamonkeyman.com/Ablert_Fred1.html
64 posted on 07/31/2016 4:49:24 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 63 | View Replies]

To: TigerLikesRooster

Krooked Klintoon lKash ...


65 posted on 07/31/2016 5:02:10 AM PDT by VRWC For Truth (FUBO & FUHRC too ...)
[ Post Reply | Private Reply | To 1 | View Replies]

To: thesligoduffyflynns

who sold it to them?

somebody sold them the dope

######################################

Would our own North American drug cartels ship it all the way from Mexico to North Korea?


66 posted on 07/31/2016 5:06:19 AM PDT by Graybeard58 (Bill and Hillary Clinton are the penicillin-resistant syphilis of our political system.)
[ Post Reply | Private Reply | To 50 | View Replies]

To: fieldmarshaldj

What the South Koreans should do, is send 5000 missionaries into the country after reunification, and share the gospel with Christ.


67 posted on 07/31/2016 5:33:04 AM PDT by MuttTheHoople (Yes, Liberals, I question your patriotism)
[ Post Reply | Private Reply | To 49 | View Replies]

To: BobL

#26 that is because you have to use a mirror to read it.


68 posted on 07/31/2016 6:11:41 AM PDT by minnesota_bound
[ Post Reply | Private Reply | To 26 | View Replies]

To: TigerLikesRooster

His family, friends and even his goldfish are probably dead meat at this point.


69 posted on 07/31/2016 6:30:37 AM PDT by Joe Boucher (Go Trump, Give em hell BABY.)
[ Post Reply | Private Reply | To 4 | View Replies]

To: TigerLikesRooster

How could he carry that much money with him?
What are the chances the Chinese will keep the money and send him back?


70 posted on 07/31/2016 7:13:17 AM PDT by Bigg Red (You're on fire, stupid!)
[ Post Reply | Private Reply | To 4 | View Replies]

To: minnesota_bound
Cool, thanks, that worked. Other systems work too. Take this one: 장 - rotate it 90 degrees counterclockwise and it reads "knock out".
71 posted on 07/31/2016 7:22:28 AM PDT by BobL (A vote for anyone but Trump is a vote that HELPS HILLARY. Think about it.)
[ Post Reply | Private Reply | To 68 | View Replies]

To: TigerLikesRooster

Bring him here, I bet he’s got a lot to reveal, but I assume B. Hussein would want to protect his hero Kim Jong Un.


72 posted on 07/31/2016 7:26:45 AM PDT by GrandJediMasterYoda (By His wounds we are healed.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: TigerLikesRooster

They all must hate their wives, children and extended famlies. But 40 million can do that to a person.


73 posted on 07/31/2016 7:49:08 AM PDT by fella ("As it was before Noah so shall it be again,")
[ Post Reply | Private Reply | To 1 | View Replies]

To: TigerLikesRooster

“N. Korean General Defects Seeking Political Asylum”

better than waiting around in NK to find out when he’s gonna be executed with an anti-aircraft gun.


74 posted on 07/31/2016 9:15:09 AM PDT by catnipman (Cat Nipman: Vote Republican in 2012 and only be called racist one more time!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: TigerLikesRooster

If you knew it was coming...$40 million and taking your chances in China is better than being shot with an anti-aircraft gun.


75 posted on 07/31/2016 9:19:27 AM PDT by Fitzy_888 ("ownership society")
[ Post Reply | Private Reply | To 1 | View Replies]

To: fella

The NK’s policy is to confiscate property and imprison three generations for the sins of one.

This limits the extent to which vendettas/revenge might play out as the nuclear family is immediately reduced to the lowest class (literally termed “hostile”) and it will take many-many generations (if ever) to return to any stature.


76 posted on 07/31/2016 9:28:01 AM PDT by Fitzy_888 ("ownership society")
[ Post Reply | Private Reply | To 73 | View Replies]

To: fieldmarshaldj
China knows this has all been going on, but are probably content to keep NK as a bulwark against a free South Korea.

What bulwark? China and South Korea are practically best friends now - and they share a deep hatred and distrust of Japan. China's only interest in propping up the North Korean regime is in keeping millions of refugees from flooding north across their border. They have simply made the cold calculation that it is better for millions to suffer under the Kim tyranny than to have to deal with the mess after its fall.

77 posted on 07/31/2016 9:30:58 AM PDT by Mr. Jeeves ([CTRL]-[GALT]-[DELETE])
[ Post Reply | Private Reply | To 49 | View Replies]

To: BobL

This is what happens when the asians drink too much Sake.
They cannot write afterwards. They just make scrawls.
https://i.kinja-img.com/gawker-media/image/upload/v0iphbt48wlywv8ldxil.jpg


78 posted on 07/31/2016 9:32:28 AM PDT by minnesota_bound
[ Post Reply | Private Reply | To 71 | View Replies]

To: fieldmarshaldj

It almost sounds as if the North Koreans are the asian equivalent of Aboriginines compared to the average Australian. The tragedy is the North Korean generational meltdown was knowingly caused and prolonged, while Aboriginines are that way by nature and culture. The Abs are capable of learning and many have become integrated into the larger society. Many of the North Koreans may already have irreversible brain damage, DNA damage.


79 posted on 07/31/2016 9:37:31 AM PDT by lee martell
[ Post Reply | Private Reply | To 37 | View Replies]

To: minnesota_bound

My God...didn’t realize they get THAT RIPPED over there.


80 posted on 07/31/2016 9:40:42 AM PDT by BobL (A vote for anyone but Trump is a vote that HELPS HILLARY. Think about it.)
[ Post Reply | Private Reply | To 78 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-8081-100 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson