Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

North Korea Nukes US In Propaganda Video
Sky News ^ | March 26, 2016

Posted on 03/26/2016 5:27:50 AM PDT by TigerLikesRooster

North Korea Nukes US In Propaganda Video

Kim Jong-Un lays waste to Washington with a submarine-launched nuclear missile in Pyongyang's latest menacing video.

10:20, UK, Saturday 26 March 2016

North Korea has threatened to lay waste to Washington with a submarine-launched nuclear missile in a menacing propaganda video.

The four-minute film - titled Last Chance - runs through the history of US-Korea relations, including images of US prisoners of war on Korean soil.

It ends with a digitally-enhanced sequence showing a missile emerging from the clouds and slamming into the road in front of the Lincoln Memorial - sending a wave of destruction across Washington.

As the US Capitol building burns, a message flashes up on the screen in Korea: "If US imperialists budge an inch toward us, we will immediately hit them with nuclear (weapons)."

(Excerpt) Read more at news.sky.com ...


TOPICS: Extended News; Foreign Affairs; News/Current Events; Russia; Syria
KEYWORDS: china; dprk; nkorea; norks; northkorea; nuke; pyongyang; republicofkorea; russia; syria; us
Navigation: use the links below to view more comments.
first 1-2021-23 next last

1 posted on 03/26/2016 5:27:50 AM PDT by TigerLikesRooster
[ Post Reply | Private Reply | View Replies]

To: TigerLikesRooster; AmericanInTokyo; Steel Wolf; nuconvert; MizSterious; endthematrix; ...

P!


2 posted on 03/26/2016 5:28:21 AM PDT by TigerLikesRooster
[ Post Reply | Private Reply | To 1 | View Replies]

To: TigerLikesRooster

This is highly provocative.

We could respond by bombing them into oblivion with conventional bombs...


3 posted on 03/26/2016 5:33:46 AM PDT by Innovative ("Winning isn't everything, it's the only thing." -- Vince Lombardi)
[ Post Reply | Private Reply | To 1 | View Replies]

To: TigerLikesRooster

If anyone deserved a preemptive strike besides Iran.


4 posted on 03/26/2016 5:34:23 AM PDT by disndat
[ Post Reply | Private Reply | To 2 | View Replies]

To: TigerLikesRooster

Meh. It’s the NK. This is all they do, make cheap prop videos about the US. They can’t do anything else.


5 posted on 03/26/2016 5:39:14 AM PDT by Dallas59 (Only a fool stumbles on things behind him.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: TigerLikesRooster

Probably produced in Hollywood. I think the Nork film industry consists of two students with a 16mm wind-up Bell & Howell.


6 posted on 03/26/2016 5:41:30 AM PDT by IronJack
[ Post Reply | Private Reply | To 1 | View Replies]

To: disndat

Now all we need is a president who doesn’t agree with the Norks or Iran.


7 posted on 03/26/2016 5:42:30 AM PDT by Vaquero ( Don't pick a fight with an old guy. If he is too old to fight, he'll just kill you.)
[ Post Reply | Private Reply | To 4 | View Replies]

To: Dallas59

They were making and using exceptionally good counterfeit US currency (called ‘supernotes’, IIRC) which I believe is an act of war.

The sooner the north falls apart, the better for well, the whole world in the long run.


8 posted on 03/26/2016 5:44:32 AM PDT by Riley (The Fourth Estate is the Fifth Column.)
[ Post Reply | Private Reply | To 5 | View Replies]

To: Vaquero

Or Cuba.


9 posted on 03/26/2016 5:51:47 AM PDT by disndat
[ Post Reply | Private Reply | To 7 | View Replies]

To: TigerLikesRooster

He is just following his mentor Putin:

Russia can turn the USA into radioactive ash.
https://www.youtube.com/watch?v=uE4tbOtizts


10 posted on 03/26/2016 5:51:48 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Innovative

Curtis LeMay damned near did the job in the 1950s...


11 posted on 03/26/2016 6:01:17 AM PDT by Eric in the Ozarks (Baseball players, gangsters and musicians are remembered. But journalists are forgotten.)
[ Post Reply | Private Reply | To 3 | View Replies]

To: AdmSmith
North Koreans do not need a mentor to inspire them when it comes to this kind of shtick. They are in the league of their own.
12 posted on 03/26/2016 6:04:06 AM PDT by TigerLikesRooster
[ Post Reply | Private Reply | To 10 | View Replies]

To: TigerLikesRooster

That is correct, but they have the same ideas about dominance.


13 posted on 03/26/2016 6:08:24 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12 | View Replies]

I should have said colleague instead of mentor.
14 posted on 03/26/2016 6:11:24 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 13 | View Replies]

To: disndat

Yes.


15 posted on 03/26/2016 6:17:29 AM PDT by b4its2late (A Liberal is a person who will give away everything he doesn't own.)
[ Post Reply | Private Reply | To 4 | View Replies]

To: AdmSmith

I didn’t see any reference to Putin in that video.

The fact is, Putin’s experience during the Cold War gave him the perspective to understand that if Russia were to engage in a nuclear exchange with the United States, that even if we did not apply the “launch on warning” so far as our own weapons are concerned, our second strike capability would utterly decimate Russia.

Putin is going to engage in saber rattling, authorizing TU-95 Bear bombers to test our air defenses, all of that stuff, but he knows that there are limits, he knows how to play the game.

Not so Kim Jong Fat Boy and his deluded followers. They have no logical perspective to keep them from going too far and they believe they are somehow immune from nuclear retaliation. They don’t need to develop an actual working SLBM, they can work towards moving one of their primitive nukes into one of our ports via container ship surreptitiously, and they’re just f—king stupid enough to try it.


16 posted on 03/26/2016 6:25:55 AM PDT by mkjessup (Ted Cruz - Endorsed by JEB BUSH, MITT ROMNEY, LINDSEY GRAHAM & GLENN BECK!!)
[ Post Reply | Private Reply | To 10 | View Replies]

To: Eric in the Ozarks; All
Curtis LeMay damned near did the job in the 1950s...

One of the truly great Americans of all time.

Usually pictures of Curtis LeMay show him in uniform, chomping on a cigar, the essential epitome of a warrior, but here is
a picture I really like of LeMay enjoying some casual time, working on his '58 ('59?) Corvette ...

Image and video hosting by TinyPic

May God rest his soul.


17 posted on 03/26/2016 6:36:44 AM PDT by mkjessup (Ted Cruz - Endorsed by JEB BUSH, MITT ROMNEY, LINDSEY GRAHAM & GLENN BECK!!)
[ Post Reply | Private Reply | To 11 | View Replies]

To: mkjessup

Great pix !

Thanks.


18 posted on 03/26/2016 6:45:13 AM PDT by Eric in the Ozarks (Baseball players, gangsters and musicians are remembered. But journalists are forgotten.)
[ Post Reply | Private Reply | To 17 | View Replies]

To: AdmSmith; AnonymousConservative; Berosus; Bockscar; cardinal4; ColdOne; Convert from ECUSA; ...

19 posted on 03/26/2016 7:37:14 AM PDT by SunkenCiv (Here's to the day the forensics people scrape what's left of Putin off the ceiling of his limo.)
[ Post Reply | Private Reply | View Replies]

To: mkjessup
I didn’t see any reference to Putin in that video.

In the video you can see Dmitry Konstantinovich Kiselyov.

In December 2013 he was appointed by Russian President Vladimir Putin to head the new official Russian government-owned international news agency Rossiya Segodnya, a 2,300-person organization made up largely of the former RIA Novosti news agency and the shortwave radio station Voice of Russia. He also serves as deputy director of Russian state TV holding company VGTRK.

(In Choosing Kiselyov, Media Critics Say Putin Opts For Personal Propagandist )
http://www.rferl.org/content/russia-media-kiselyov-propagandist/25195932.html

What is worrying is that Putin has very little knowledge about military affairs and are not known for listening to others. He can make big mistakes quickly.

20 posted on 03/26/2016 8:40:44 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16 | View Replies]


Navigation: use the links below to view more comments.
first 1-2021-23 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson