Skip to comments.
Volcanic origin of proteins?
The Scientist ^
| 21st March 2011
| Hannah Waters
Posted on 03/23/2011 1:51:59 AM PDT by AdmSmith
click here to read article
Navigation: use the links below to view more comments.
first 1-20, 21-40, 41-60, 61-63 next last
Positive impacts of volcanoes
1
posted on
03/23/2011 1:52:07 AM PDT
by
AdmSmith
To: SunkenCiv; decimon; neverdem; nuconvert
2
posted on
03/23/2011 1:53:30 AM PDT
by
AdmSmith
(GCTGATATGTCTATGATTACTCAT)
To: AdmSmith
Holy Cow! L. Ron was right!?
3
posted on
03/23/2011 1:59:35 AM PDT
by
DeltaZulu
To: DeltaZulu
No, in his SF books it was 75 million years ago that Xenu landed. LOL!
4
posted on
03/23/2011 2:03:39 AM PDT
by
AdmSmith
(GCTGATATGTCTATGATTACTCAT)
To: AdmSmith
......In the 1950s, Stanley Miller and Harold Urey of the University of Chicago performed a series of "spark discharge" experiments, in which the researchers applied electrical sparks-- meant to simulate lightning -- to a mixture of gases in steam-filled flasks...
To: AdmSmith
One spark-discharge experiment using radioactivity ran all night and in the morning the vessel was found broken open. Little footprints of black goo led to the window and a note was left........ What did the note say?
“Gone fission!”
6
posted on
03/23/2011 3:46:47 AM PDT
by
count-your-change
(You don't have be brilliant, not being stupid is enough.)
To: DeltaZulu; AdmSmith

It all began 75 million years ago with a galactic federation of planets ruled by the evil Lord Xenu, Fearing overcrowding, Xenu rounded up countless aliens from all those planets and had those aliens frozen. The frozen alien bodies were loaded onto Xenu's galactic cruisers, which looked like DC-8s, except with rocket engines. They were sent to earth and dumped into the volcanoes of Hawaii and other volcanoes. They were no longer frozen. They were dead. "The souls of the aliens floated toward the sky," the president continued, explaining that Xenu had built giant "soul catchers" to collect them all and unload them into a brainwashing facility he had built on earth. "The souls were forced to watch days of brainwashing material that tricked them into believing a false reality," the president revealed. "Xenu then released the alien souls that roamed the earth aimlessly in a fog of confusion. At the dawn of man the aliens found bodies they could grab onto. They attached themselves to all mankind, which still to this day causes all our fears, confusions and problems."
7
posted on
03/23/2011 4:01:49 AM PDT
by
Vaquero
("an armed society is a polite society" Robert A. Heinlein)
To: AdmSmith
Since Miller and Urey's experiment was utterly discredited as an origin-of-life scenario, the scientists have now backed off and want to use it as a scenario for the origin of proteins/amino acids. Fine, but it does not solve the REAL problem in origin of life: Where did the information contained in DNA and RNA come from?
8
posted on
03/23/2011 4:56:38 AM PDT
by
backwoods-engineer
(Any politician who holds that the state accords rights is an oathbreaker and an "enemy... domestic.")
To: backwoods-engineer
Fine, but it does not solve the REAL problem in origin of life: Where did the information contained in DNA and RNA come from? It's pretty much the same all over. Look at metallurgy. Sure, they've figured out some interesting stuff, but it basically just worthless crap, because it doesn't tell us where the metal came from.
To: tacticalogic
Just tell me where the gold comes from and I’ll go get as much of it as I can.
10
posted on
03/23/2011 5:54:08 AM PDT
by
muawiyah
(Make America Safe For Amercans)
To: tacticalogic
Uhhh... that's kind of different. Metal is a material created in the hearts of stars of various kinds. That can be observed directly, by spectroscopy.
Information is created by a mind. A metallic crystalline structure has symmetry and regularity, but that isn't information.
11
posted on
03/23/2011 6:22:35 AM PDT
by
backwoods-engineer
(Any politician who holds that the state accords rights is an oathbreaker and an "enemy... domestic.")
To: muawiyah
Just tell me where the gold comes from and Ill go get as much of it as I can.Sorry, can't help. I could say "It comes from volcanic eruptions and vents", but that doesn't answer the question, because it doesn't tell you where it came from before that.
To: backwoods-engineer
Information is created by a mind. That's true. Without a mind to organize and analyze it, it's just data.
To: muawiyah
Type II supernovae of between 40 and 80 solar masses. It happens during the collapse. Don’t get burned trying to get it!
14
posted on
03/23/2011 6:59:56 AM PDT
by
backwoods-engineer
(Any politician who holds that the state accords rights is an oathbreaker and an "enemy... domestic.")
To: muawiyah
To: AdmSmith
“Well, Bobby, another one of those big questions for Mr. Science. ‘Can volcanoes produce life?’ Hmmm. You know the Mr. Science motto, ‘Doing Is Knowing!’ We have here a bowl of boiling cheese-dip to simulate the lava in a volcano. Here is our bottle of hydrogen and a sparkler to simulate lightning. Just a second. The court order requires that the fire department be notified whenever I conduct an experiment. Have we done that Director Lisa? OK! Here we go. We turn on the hydrogen...and put the lit sparkler over the cheese. HOTCHEESE!!!HOTCHEESE!!!HOTCHEESE!!! Thanks Cameraman Steve. That cheese-lava can really scald you. Once again, science triumphs over superstition! ‘Can volcanoes produce life?’ The answer is no, volcanoes can produce third-degree burns. Mr. Science has been receiving letters requesting him at birthday parties. The District Attorney has threatened to throw Mr. Science in Jail ‘until the end of time’ if he works at any more birthday parties. I will be at the Harrison Avenue Mall this Saturday from noon to four demonstrating volcanoes. Free nachos, too!”
16
posted on
03/23/2011 8:03:26 AM PDT
by
blueunicorn6
("A crack shot and a good dancer")
To: 75thOVI; agrace; aimhigh; Alice in Wonderland; AndrewC; aragorn; aristotleman; Avoiding_Sulla; ...
17
posted on
03/23/2011 5:06:15 PM PDT
by
SunkenCiv
(The 2nd Amendment follows right behind the 1st because some people are hard of hearing.)
To: KevinDavis; annie laurie; garbageseeker; Knitting A Conundrum; Viking2002; Ernest_at_the_Beach; ...
Thanks AdmSmith. Panspermia ping.
18
posted on
03/23/2011 5:06:25 PM PDT
by
SunkenCiv
(The 2nd Amendment follows right behind the 1st because some people are hard of hearing.)
To: AdmSmith; StayAt HomeMother; Ernest_at_the_Beach; 1010RD; 21twelve; 24Karet; 2ndDivisionVet; ...
19
posted on
03/23/2011 5:06:25 PM PDT
by
SunkenCiv
(The 2nd Amendment follows right behind the 1st because some people are hard of hearing.)
To: AdmSmith
This is as likely as a Boeing 757 being left behind after a tornado sweeps through a junk yard. And this theory fails to account for the information required to assemble amino acids into proteins. And, it fails to account for teleonomy and autopoiesis. I will invoke Polanyi’s Impossibility here!
20
posted on
03/23/2011 7:06:25 PM PDT
by
LiteKeeper
("Psalm 109:8")
Navigation: use the links below to view more comments.
first 1-20, 21-40, 41-60, 61-63 next last
Disclaimer:
Opinions posted on Free Republic are those of the individual
posters and do not necessarily represent the opinion of Free Republic or its
management. All materials posted herein are protected by copyright law and the
exemption for fair use of copyrighted works.
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson