Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Pakistan arrests American hunting for bin Laden (an American civilian)
AFP ^ | 6/15/2010 | S.H. Khan

Posted on 06/15/2010 5:42:02 AM PDT by markomalley

PESHAWAR, Pakistan — An American businessman armed with a pistol, dagger and a sword has been arrested in Pakistan on suspicion of wanting to hunt down and kill Osama bin Laden, police said Tuesday.

The 50-year-old from California was detained on Monday in what was apparently the first such case in Pakistan since the United States offered a bounty of 25 million dollars for the world's most-wanted man.

The suspect was arrested in the northern mountains of Chitral, once a rumoured hiding place of bin Laden, near Afghanistan's Nuristan province, said police officer Mumtaz Ahmad Khan.

Police identified him as Gary Brooks Faulkner. He was caught armed with a pistol, a dagger and a sword, carrying night-vision goggles, a night-vision camera and religious literature on Christianity, Khan said.

Police said the American -- who suffers from kidney problems and high blood pressure -- arrived as a tourist in the district of Chitral, checked into a hotel and was given the customary security escort, before he vanished.

"On Sunday night, our security guard noticed that Gary had disappeared. A search operation was launched and we found him 14 kilometres (nine miles) short of the Pakistan-Afghan border. He was trying to enter Nuristan," said Khan.

Nuristan is a stronghold of Taliban militants.

(Excerpt) Read more at google.com ...


TOPICS: Foreign Affairs; Front Page News; War on Terror
KEYWORDS: chitral; nuristan
Navigation: use the links below to view more comments.
first previous 1-2021-4041-48 last
To: markomalley

Boy, that’s optimism for you.


41 posted on 06/15/2010 1:25:05 PM PDT by TexasRepublic (Socialism is the gospel of envy and the religion of thieves)
[ Post Reply | Private Reply | To 1 | View Replies]

To: swarthyguy

Thanks for the ping Swarthy Guy.

It was probably that Christian literature that got the poor guy arrested.

###

Stepping back in time...

http://www.freerepublic.com/tag/chitral/index

http://www.freerepublic.com/tag/nuristan/index

###
###

http://www.freerepublic.com/focus/f-news/1756003/posts

Afghanistan ‘holds Pakistani spy’(Escorted Bin Laden last year from Nuristan to Chitral)
BBC ^ | Dec 19 2006 | Not given
Posted on December 19, 2006 4:50:22 PM PST by Dog

###
###

http://www.freerepublic.com/focus/f-bloggers/2208074/posts

“...How we Know AQ#1 Surfs the Internet & What this tells us about his location”
THE JAWA REPORT ^ | March 15, 2009 | Rusty
Posted on March 16, 2009 10:31:18 PM PDT by Cindy


42 posted on 06/15/2010 1:58:08 PM PDT by Cindy
[ Post Reply | Private Reply | To 39 | View Replies]

To: swarthyguy; AdmSmith; Cap Huff
I laughed when I first heard of this guy and thought swarthy went off the damn deep end and went hunting.

BTW this man was sniffing around the right area if you ask me.

43 posted on 06/15/2010 2:11:49 PM PDT by Dog (Only reads headlines since 2000)
[ Post Reply | Private Reply | To 37 | View Replies]

To: markomalley

It’s a shame this swashbuckling gentleman didn’t succeed. Can you imagine the news afterwards?

American Christian militant assassin murders Osama Bin Laden in cold blood. Pakistani forces arrest militant Christian assassin and are holding him for trial.

American President obama calls for his immediate execution to send a message to Christian Terrorists.


44 posted on 06/15/2010 2:18:28 PM PDT by Dr.Zoidberg (Warning: Sarcasm/humor is always engaged. Failure to recognize this may lead to misunderstandings.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Dr.Zoidberg

I’d like to know what sort of sword he carried. It would be a nice touch if it were a 12th century (or so) arming sword. Something like a crusader might have carried.

At 40”... that might be the case, though it also might be one of those dang ubiquitous katanas. [sigh]. Just not period-correct. :-)


45 posted on 06/15/2010 2:47:01 PM PDT by Ramius (Personally, I give us... one chance in three. More tea?)
[ Post Reply | Private Reply | To 44 | View Replies]

To: Dog; swarthyguy; Cap Huff; nuconvert
Well, we should see what our favorite newspaper is printing:

Chitral — —An American national Gary Brooks Faulkner was arrested from the Bumburet Kalash valley of Chitral, reportedly trying to cross over into Nuristan province of Afghanistan which borders the area. The suspect was reportedly armed with a pistol a dagger and a scimitar and he was repeatedly expressing his intentions of crossing into Afghanistan and fighting the Taliban and Osama. The arrested person had visited Pakistan on seven occasions earlier. (Muhkamuddin, 15 June 10)

And there was a letter:

US national arrested in Chitral -letter

The way the subject news has been splashed across the global media in a flash, seems to be a sinister plan from somewhere to antagonise the local population against Christians, as some western papers have reported the gentleman was carrying biblical verses on him when caught. I hope Chitralis will take the whole story with a pinch of salt and dismiss such sensationalism to continue with their peaceful tranquil and tolerant way of life.

Muhammad Arif,

Chitral,

15 June 10.
http://www.chitralnews.com/News-15-6-10.htm

46 posted on 06/15/2010 4:56:32 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 43 | View Replies]

To: Ramius; Cindy
Well, I'm going to go against the 'arm-chair commandos' here and give the guy a big Ol Attaboy!

First - his choice of weapons makes a lot of sense. Pistol, knife and long-blade. All good CQB weapons. As to the long-blade, sword, personally, I don't think that is going to attract all that much negative attention in the area he was operating, or going to be operating, in. Sword carrying id pretty much a given in those tribal areas. So it looks like he has done his background and is prepared weapon-wise. If push-comes-to-shove I think it more likely that his encounter with bL will occur in a room rather than on a range. But, like I say, I think if he finds a need to reach out and let Ol bL hold one from 300 meters...he would be able to 'acquire' the appropriate hardware. Just a hunch.
If you need a 'rifle' or 'long gun', its not hard to find one in a war-zone. And that what he is operating in - a war zone.

Second - Now I don't know about the rest of y'all, but 50 yrs old and a 'construction worker' kind of leads me to believe that he may have the physicality' part of this job under control. *I have not seen any photos of him or have any inside dope about him*...but being as how this isn't his "first rodeo" into this area looking for bin Lain, I'd have to give him the benefit of doubt that he's got the physical aspects under control. Yeah, I know, he had BP meds and something else with him...So what? It just shows he's prepared. (disclaimer - I take BP meds and do silly-ass running and physical activity 4 - 6 times a week...and I'm 9 yrs past 50)

Thirdly - So he had "Christian literature" with him. I've had a small Bible wrapped in duct tape with me for almost 35 yrs. Always take it with me when I travel. It even has some parts high-lighted so I can see 'em better. I see no problem with a Christian having some inspirational lit with him. Especially when venturing into the enemies mountainous kingdom. I think it might be good to feel that the Lord is with ya on some venture like this.
And of course, being as this is a Mohammadan country, his having Christian literature with him is going to fluff a few turbans. Nature of the game.

So my take on this is Good for You Sir!..its self-motivated individuals such as you who make things happen. Break Contact and CTM!
47 posted on 06/15/2010 6:01:13 PM PDT by Tainan (Cogito, ergo conservatus)
[ Post Reply | Private Reply | To 37 | View Replies]

To: markomalley

I’ve been going around all day to my bosses reassuring them that this was not me and that I am still in the country.

Sheesh, one nut case gets caught hunting bin Laden in the badlands of Pakistan and it makes all us gun and sword totin mainiacs look bad.

But, as has been pointed out before, according to his story this was his THIRD trip to the area. Musta had something going right for him.


48 posted on 06/15/2010 6:20:59 PM PDT by Have Ruck - Will Travel (Hmm, I wonder what would happen if I...)
[ Post Reply | Private Reply | To 1 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-48 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson