Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Why Russia will lose this war?
Kamil Galeev via Twitter ^ | February 27, 2022 | Kamil Galeev

Posted on 09/30/2022 9:48:20 PM PDT by Zhang Fei

Why Russia will lose this war?

Much of the "realist" discourse is about accepting Putin's victory, cuz it's *guaranteed*. But how do we know it is?

I'll argue that analysts 1) overrate Russian army 2) underrate Ukrainian one 3) misunderstand Russian strategy & political goals🧵 Image

Consider a timely paper on Russian army by Bismarck Analysis. It's good & informative. It's correct on its land-based and artillery-centric character. It's also correct that Minister of Defence Serdyukov greatly increased army's efficiency in 2007-2012. But it's still misleading Image

Yes, Minister Serdyukov indeed reformed the army. He increased its efficiency, fought with corrupt and crony armament producers improving the army supplies. As a result he became extremely unpopular, made tons of powerful enemies and was ousted in 2012 losing his power and status Image

His successor Shoygu knew better than that. Now who's Shoygu? Shoygu is the *only* single Russian minister who uninterruptedly worked in government since 1991, since the very beginning of Russian Federation. He worked for all presidents, all prime ministers avoided all purges Image

What does it mean? It means he's a cunning political entrepreneur, great in court politics, publicity, image. You survive every single administration by maxing your political survival. And to max it you need to minimise animosity. So you never object to powerful interest groups Image

Serdyukov fought with interest groups and was destroyed. Shoygu was smarter than that. He launched a PR campaign presenting himself as the "saviour" from the Serdyukov's legacy. Whatever his predecessor did, was dismantled. Media cheered, people cheered, interest groups cheered Image

That's a very, very typical problem. Efficiency-maxing requires ruthlessness in dealing with established elites and interest groups. Meanwhile court-politics-maxing requires pondering to them and not making enemies. Serdyukov was maxing efficiency, Shoygu - court politics Image

There was another issue. Shoygu is ethnic Tuvan. In such a country as Russia minority member can hardly become the supreme leader. People don't perceive him as ethnic Russian (see his palace) which means he's not dangerous for the leader and you can safely delegate him the army Image

Shoygy not only purged Serdyukov's appointees, pondered to old military establishment, stopped arguing with army suppliers about the equipment cost and quality. He also pondered to numerous feel-good-lies regarding the Russian big strategy. Let's consider the army vs navy problem Image

Army vs navy had been a traditional dilemma of European powers for centuries. As a rule, you couldn't support both first class army and first class navy, you had to choose. Some powers ignored this to their demise - like 17-18th cc France. Others were more rational, like Prussia Image

We kinda forgot it but in the 17th c principality of Brandenburg centered in Berlin tried to play into a "global maritime power". They built a navy, established colonies in Caribbean and Africa (red). Super costly, super hubris, super stupid. Consumed tons of resources in vain Image

In 18th c. they reconsidered. They sold their colonies, dismantled the navy and started land-maxing. They correctly realised that if they suppress their hubris and minimise the navy (to zero), they can land-max and build the first class army. Which would then unify Germany Image

So. Land-maxing requires minimising the naval ambition. Does Russia minimise its naval ambition? No. It feels obliged to maintain as much Soviet naval legacy as possible. Keep old ships afloat, build new ones, maintain and expand infrastructure for the ocean navy Image

Here is another dilemma. Regional fleets can be effectively used in land wars. For example, Russia declared "navy manoeuvres" and then attacked Ukraine from the sea. That's cheap and effective. But keeping a regional fleet doesn't sound sexy. It's efficiency-maxing, not PR-maxing Image

And Russia is PR-maxing. Putin declared that the share of new ships should reach 70% by 2027. Old Soviet ships are becoming obsolete, Russia's building new ones. BUT. Major Soviet shipyards are located in Ukraine. So now Russia expands shipyard infrastructure to reach this goal Image

Soviet naval legacy is a curse of Russian military. USSR could afford ocean fleets with carrier strike group. Russia can't. But abandoning Soviet ambitions would require suppressing their own hubris (impossible). So they strive to maintain it. Ergo: they can't and won't land-max Image

How does it reflect on this war? First, Russian invading force is small. It has LOTS of artillery ofc. But it's not numerous enough to win. Pro-Russian analysts compare their advance with Barbarossa. But unlike Wehrmacht in 1941 Russian invaders have only *ONE ECHELON OF TROUPS* Image

How is a Blitzkrieg organised? By echelons. First echelon is moving forward as fast as they can. Ofc this means that lots of defenders will be left in their rear. But then the second echelon comes, then third, etc. They finish defenders, occupy territory, control the supply lines Image

If Russia launched a proper Barbarossa-style Blitzkrieg that would happen now - first, second, third echelons. But the second echelon didn't come. It never existed. Why? First, Russia's *not* landmaxing and thus doesn't have so much resources and infrastructure for the land war

Secondly, launching several echelons would require long arduous preparation. You need to mobilise them, move to the borders, quarter, maintain and supply. It's not that easy. It's a hard job that should have been done well in advance to wage a Blitzkrieg. And it hadn't been done

Why Russia didn't prepare a proper Blitzkrieg? And now we come for the third and main reason. Blitzkrieg is a war strategy. Blitzkrieg is how you break & suppress the enemy who's actually fighting. Russia didn't plan it because it didn't plan a war. It planned a Special Operation Image

Ofc partially that's just modern discourse. After WWII traditional understanding of sovereignty as of legal right of sovereign rulers to wage offensive war died. As a result modern states never admit they're waging wars. They're waging "pacifications", "counterterrorism", etc

Consider how all the War Departments and Ministries over the world were renamed into "Defence" in late 1940s. Everyone's defending, nobody's attacking. Why does the fighting happen then? Well, because of criminals - "bandits", "terrorists", "jihadees" or as now in Ukraine "Nazis"

Modern world abolished the distinction between the enemy and the criminal, a key idea of the Roman Law. Powers do wage wars, but to do so they need to criminalise and dehumanise their enemies. Hence, all the "terrorist" discourse. In a sense Putin is going with the flow

But on a deeper level Putin is absolutely correct. His declaration of "special operation" in Ukraine is sincere, because he didn't expect the war. He doesn't know how to do wars. For all of his life he's been organising and launching the special operations

First, as a KGB officer. Then, as St Petersburg city councillor for foreign affairs (= illegally selling Soviet warehouse stuff to the West). In 1990s he closely worked with the criminal world and he did it successfully. Here you see him with a thief-in-law, Grandpa Hassan Image

Btw that's how Putin's pal Grandpa Hassan is celebrating with his close circle. It gives some idea of Putin's business partners and associates

Putin worked with violent entrepreneurs used to killing. But. He had always had the upper hand. Federal and regional governments were very much stronger than these criminal bosses who were very much replaceable. Everyone of them had dozens of henchmen who wanted to take his place

Putin waged special operations when he had much stronger position than these criminals. And he got used to that. Later Yeltsin chose him as a successor and in this capacity Putin launched a bunch of special operations to consolidate power. Again with full support of higher ups Image

Yeah, Putin played badass even before becoming a President. But it was easy to play a badass when he was backed up by then President and the entire apparatus of Kremlin. Huge power, no risk, no accountability Image

Later he initiated conflicts each time his had to boost his popularity and tough image. Chechnya, Georgia, Syria. But neither of this was a war. Every conflict was a Special operation waged:

1) for political goals
2) against small force which had no chance to win against Russia Image

Putin fought only with small countries. Chechnya - 1 million people, Georgia - 4. Syria had more, but he fought with rebels, with no proper training or armaments. Also "counterterrorist" discourse allowed Russians to simply level entire cities to the ground with no consequences Image

Every time Putin needed to confirm his alpha status he would devastate some little country with a Special Operation. They didn't require proper preparation because they bore no existential risk to Russia or to him. Like, the f*** they're gonna do? No risk = no need to bother Image

Putin decided to repeat this little trick again. Hence, not that numerous army of invasion, only one echelon of advance, etc. But Ukraine is much bigger - it has 44 million people. What was Putin thinking? Apparently he was expecting zero resistance from the Ukrainian army Image

Putin had a good reason to believe so. Indeed, in 2014 Russian regulars ("ихтамнеты" = "there aren't any of them there") easily destroyed Ukrainian forces in Debaltsevo and Ilovaysk. He saw that Ukrainian army is weak and he can easily route them simply sending Russian regulars Image

Strategically speaking Putin f***ed up. He defeated Ukraine, inflicted pain and humiliation. Anyone with an IQ above the room temperature knew the war is not over and Russians would strike again. But - Putin didn't finish Ukraine back then. He thought he'd always have a chance Image

What happened next was quite predictable. Inflicting a painful but not critical defeat on your enemy is risky. Yeah, they kinda became weaker. But the balance of power within them changed. Court politics maxing interest groups lost and efficiency maxing upstarts get a chance Image

Formula of institutional evolution = scare + don't finish them. Napoleon smashed Prussians at Jena-Auerstedt, didn't finish them. Prussia evolved. Commodore Perry scared Japanese in 1853, but the US spiralled into Civil War and left them alone. Japan evolved Image

Nothing motivates as hard as an existential threat. First, Ukrainians admitted the truth:

«I'll be frank. Today we have no army. Now we can assemble a group of 5 thousand capable soldiers max [out of 125 on paper]"

- reported minister of defence in 2014

I'll make a pause, gonna resume in an hour or so. To be continued soon

In 2014 Ukrainian equipment was awful. Almost 100% vehicle and ammunition were 25+ year old Soviet stocks. Moreover, most of it just expired. Like vehicles existed on paper but were never checked or used since 1991. Their radiators, accumulators all rotten and unrepairable

FSB colonel who led pro-Russian insurgency in 2014 admitted it created problem for him, too. He wanted to restock from the Ukrainian military warehouses, but that stuff just didn't work. Like they took 28 anti-tank missiles and fired them all during Nikolaevka battle. None worked Image

Judging by the interviews with insurgents who were disappointed to find that rockets, shells, grenades taken from Ukrainian warehouses were 99% dysfunctional (ofc, they were 25+ years old) it's not surprising Ukraine lost to Russia in 2014. It's surprising they could fight at all

Even the ancient soviet radio machines didn't work. Ukrainian soldiers had to communicate with SMS and since network was often awful they had to throw their mobile phones up in air in a hope may be it will catch radio signal few meters over the ground

That's how Ukrainian army looked back then. No wonder it was immediately crushed by Russian regulars in Debaltsevo and Ilovaysk and Putin had every reason to believe that resistance will be broken the moment he launches his regular army en masse

A lot has changed. First, Ukraine has had six drafts. Men were drafted and sent to Donbass. Then most demobilised and returned to civilian life. This Donbass contingent was around 60 thousand soldiers and constantly rotated. So now Ukraine has 400 000+ veterans of Donbass war

Many of them were in combat. Thus Ukraine has huge number of veterans with combat experience. Probably more than Russia. Yes, Russia has been fighting in Syria. It never published the size of its force but it's estimated to be 2-3 thousand. Most Russian soldiers have not seen war

Furthermore, combat they've seen is different. Russian soldiers are used to fighting only when they total superiority. In Syria they would just level cities to the ground with bombers. Meanwhile, Ukrainian soldiers have fought only against far stronger and better equipped enemy

Equipment-wise this war took Ukrainian army half-resupplied. It developed many innovative weaponry of its own, but almost none of it was produced on large scale. In most cases soldiers have only few prototypes of new, Ukrainian-produced weaponry

Ukraine ordered 48 Turkish Bayraktars TB2 drones. That's not bad - more than twice what Azerbaijan had in Karabakh. But only 12 of them got to the troops by now. Ukraine is also developing new, stronger drone Bayraktar Akinci together with Turks, but it's too late for this war Image

However, Ukrainians got a number (unpublished) of American-produced Javelins and M141 Bunker Defeat Munition, & British-Swedish produced MBT LAWs. Together with Ukrainian produced anti-tank weaponry such as «Stugna-P», RK-3 "Corsar" and «Barrier» it helps to fight Russian tanks Image

Ukrainian troops hadn't received many new tanks by the time Putin attacked. But they got new armoured vehicles, such as domestic-produced Cossack-2 with Turkish produced Aselsan fighting modules and a number of American armoured vehicles, humvees, etc Image

Finally, Ukraine created a new type of troops - the troops of territorial defence, whose number is estimated in 60 000. It's a copy of the Polish troop type. These are civilians who get military training and can be mobilised in a day to fight only in their own town and region Image

Why? Well, that's pretty obvious. If Russia made a proper Blitzkrieg with several echelons of attack, Ukraine would lose anyway. But Russia didn't. And Ukrainians bet that they wouldn't. First - it's costly and difficult for a state security regime which isn't landmaxing

Second, Putin expected Ukrainian army to run away or surrender in the first day. Like most of foreign observers expected. Now they're of course changing the narrative, but if you look at their posts few days ago they didn't believe that Ukrainians would make any real resistance

So Putin attacked with only one echelon. Troops pushed forward leaving many non-destroyed Ukrainian regulars and levy behind. In a proper Blitzkrieg a second and third echelon would have come to finish Ukrainian defenders. But they didn't. These additional echelons didn't exist Image

Which immediately created the supply and replenishment problem. The first echelon pushed forward. It needs a supply in ammo, in fuel and well, in people. But these supply convoys are being attacked by the regulars and territorial defence troops left behind  

By those few Bayraktars Ukraine got  

And reportedly by the levy whom the government just distributed guns. These people would be unable to stand against the Russian columns but they can attack convoys. Consider that Ukraine has many veterans with combat experience among civilians

Strelkov, who led pro-Russian insurgency in 2014 confirms this version in his telegram. Supply columns are being destroyed because there's no second echelon Image

Putin is apparently concerned. In the video of 25 Feb he called for Ukrainian military to do a coup d'erat. He wouldn't need it if his plan worked in the first place Image

What does it mean? Putin's plan didn't work. Cuz he didn't plan for war. He never fought a war and has no idea how to fight them. He has been always doing Special Operations and this is a Special Operation, too. They should have just run away or surrender, but they keep fighting  

The defeat in this operation will inflict enormous consequences for Putin and his regime. They are unlikely to survive this defeat. Meanwhile, it's unlikely that Putin wins by the same methods

It's not that Russian morale is low, it's rather that it depends on how hard the war is.Most Russian troops would be enthusiastic or wouldn't mind against a small foreign vacation with fun and adventures. Fighting a hard long war with real possibility of death is another matter

Now my laptop died and wouldn't turn on again, so typing from phone

Morale of Russian troops is widely overestimated. According to sociological studies the main motivation to enlist is usually to get an apartment. They are usually young men from underprivileged background with no real prospects in life. That's a chance to get a housing from state

Now if you are dead, you can't get a housing. Perhaps those already in Ukraine have little choice but the very fact that resistance continues, war is bloody and casualties are real would hugely demotivate those back at home. Expect no enthusiasm to go there on Russian side

What Putin can do?

1. Start destroying infrastructure (done)
2. Blockade cities (done)
3. Simply level cities with bombers and artillery like in Chechnya or Syria (may be)

The first two would inflict humanitarian catastrophe and as he hopes break the will

Third one is more problematic. Unlike Chechnya or Syria where you could easily justify the open genocide with "fighting jihadees" which is a fair play in the "war on terror", here it would be more difficult and actually might draw the NATO response. Still, I can't exclude this

So my prognosis is: if the fight continues and victory is not achieved Russian ability and willingness to fight will be disappearing quickly. Putin doesn't have a choice but many of his subordinates do

Even in case when Russia doesn't technically lose and some source of armistice/agreement is achieved, Ukraine already won. Why? Many describe this conflict as kinetic. Bullshit. Human conflicts or interactions are not kinetic. They are mythological and run by myths

Money is a myth. It exists only because we believe so. Power is a myth. Nation is a myth. Institutions are purely mythological. Consider the story of the burning of Moscow in 1572. Ivan the Terrible divided his country to Zemschina (land) and Oprichnina (taken apart)

Oprichnina was under his personal rule. Oprichniks - his forces - launched terror campaign against Zemschina. They slaughtered entire noble houses, massacred cities, killed enormous number of commoners facing no resistance. Why? Were they strong and brave? No. Because if the myth

Russian people existed within a myth of Orthodox monarchy. Ofc there would be individuals who would go against the Orthodox Tsar. But it was impossible to organise a resistance against him. Thus resistance would be individuals and easily crushed by organised Oprichnik forces

Oprichniks became very brave and badass. Because mythology of the Russian people prohibited 99% of them to resist these security forces. So with the time they decided they are really cool. In 1572 when Crimean Khan attacked Moscow Oprichnik forces went to face him

Kinetically speaking they had overwhelming superiority. Guns, cannons, much heavier armor or weaponry. Their defense and firepower was very much stronger. But they were routed in one day simply by arrows. Because they were used to fight people whose myth prohibited to resist them

Within the Muscovite mythology Oprichniks were invincible untouchable demigods, as hands of Orthodox Tsar, who's kinda living God. But when facing foreign enemy they left this mythological space. And entered a new space where they are just people and can get arrow in the face

They were not used to getting arrows in the face. The very realisation they are not demigods but mortals shocked them. They ran away dropping their armor, guns and cannons. Moscow was burnt to the ground despite having total "kinetic" and technological superiority

So. Power is mythological. Russian state security are gods within their own mythological space where they represent the god like state. But what they found that Ukrainians left this mythological space. Thus Russian state security has no power there. They are just mortals

And finally. The very fact of resistance against so much superior enemy very much empowers the Ukrainian mythology. It's enormous mythos building we are witnessing. The very phenomenon of war is inconceivable without taking into account mythological dimension

Consider Venice. When Napoleon came they surrendered without a shot. Very smart, saved lives, saved the city. It's just killed the mythos of Venice. People lived but the Republic died. It was never restored and is unlikely to be restored again

Theorists of war of the bygone age understood it. Clausewitz pointed out that it's important not only if you lost independence but *how* you lost it. If you submitted without a fight, you saved lives. But you killed your mythos. You'll be digested by the conqueror

But if you lost after the brutal and bloody fight your mythos is alive. The memory of the last battle will live through the ages. It will shape the mythological space your descendants live in and they'll attempt to restore independence at the first opportunity. End of thread


TOPICS: Editorial; Foreign Affairs; News/Current Events; Russia
KEYWORDS: asplanned; biden; genius; globalistpropaganda; intothegunsagain; intothegunsdearukies; intothegunsoncemore; kamilgaleev; kamilisafag; putin; russia; smartandsavvy; tacticalgenius; tothelastukrainian; ukraine
Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-79 next last
To: Zhang Fei
So now Ukraine has 400 000+ veterans of Donbass war Many of them were in combat. Thus Ukraine has huge number of veterans with combat experience

At least someone is finally admitting the war Ukraine has been waging on Russian-speaking Donbas since 2014 was a pretty big and bloody one.

21 posted on 09/30/2022 11:06:14 PM PDT by PGR88
[ Post Reply | Private Reply | To 1 | View Replies]

To: Zhang Fei
who is Kamil Galeev?
22 posted on 09/30/2022 11:12:38 PM PDT by McGruff (Don't underestimate Joe's ability to f*** things up - Barack Obama)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Zhang Fei
My main criticism is technical.

The author refers to Blitzkrieg, but the technique of multiple echelons is Soviet, not German.

The Prussians and then Germans always knew that their army was too small to fight the large enemies it would be called on to combat.

So they devised a simple but very effective set of techniques:

1) Mobility: minimum logistics train;

2) multiple semi-independent groups advancing simultaneously to find the enemy;

3) The 1st group making contact pins the enemy so he can neither advance nor retreat;

4) The other units envelop the flanks, encircle the mass of the enemy's army, and annihilate it.

5) This technique of advance, pin, envelop was applied recursively. In Barbarossa, Army Group Center was to advance on Moscow and pin the mass of the Soviet Army, North and South were to outflank. This technique extended down to division, regiment, company and even squad. Wehrmacht squads had two machine gunners and two assistants. Their job was to pin the enemy with covering fire while the rest of the squad enveloped the flanks. This technique requires very well trained soldiers and officers.

Note that the point was to kill or capture and not allow the enemy to retreat, and thereby destroy the enemy's means of resistance.

What the Germans failed to count on was that Stalin's political control of the Soviet Union was greater than Hitler's in Germany. It didn't matter how many men were killed or captured. Stalin could simply order up new divisions. The Wehrmacht performed five envelopments during June - October 1941 as big as or larger than than the 1940 campaign against France, killing or capturing over 3 million Red Army soldiers. It wasn't enough.

The thin forces and lack of logistics of the Germans meant they always had a horror of partisan or "franc tireur" activity in the rear. This encouraged heavy handed atrocities as a purportedly "efficient" way of dealing with the problem. This was already a feature of the Franco-Prussian War where the Prussian/German army would just shell the heck out of any village from which fire supposedly came. It showed up again in the destruction of Louvain and other towns in reprisals in WWI. Thin logistics also meant that in a long war the Germans used forced labor and stole what they could, as they already did in occupied France in WWI.

Putin seems to be trying to reconstitute enough units to pursue a Soviet style assault. I doubt this will succeed as he doesn't have the means of adequately arming or training the soldiers he has. The only real threat to Ukraine is Putin reconstituting another front in the north from Belarus to threaten Kiev again, which would relieve pressure in the east and south. This is also the one operation that would risk direct intervention by NATO and/or Poland. And I am certain that with better artillery and missiles, the Ukrainians would attack Russian forces in Belarus. Not sure the Crap Weasel in Chief Lukashenko is willing to risk that.

23 posted on 09/30/2022 11:12:56 PM PDT by pierrem15 ("Massacrez-les, car le seigneur connait les siens" )
[ Post Reply | Private Reply | To 1 | View Replies]

To: Zhang Fei; All


Less Than $583 To Go!!
Your MONTHLY And Quarterly Donations To FR
Help "Light The Fuse" To Speed Up The Pace
Of These FReepathons!!

Sponsoring FReepers are contributing
$10 Each time a New Monthly Donor signs up!
Get more bang for your FR buck!
Click Here To Sign Up Now!


24 posted on 09/30/2022 11:18:59 PM PDT by musicman (The future is just a collection of successive nows.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Kazan

Billboard in Donetsk city. "Thank you grandfather Biden for our victory."

25 posted on 09/30/2022 11:22:14 PM PDT by sockmonkey (Conservative. Not a Neocon.)
[ Post Reply | Private Reply | To 4 | View Replies]

To: UMCRevMom@aol.com

Aiden Aslin has returned to the UK after being detained for months following his capture by Russian-backed forces in Ukraine. Speaking to the Sun on Sunday, he said after being stabbed he was asked if he wanted a quick or “beautiful death”.
1- https://fb.watch/fTByS93Pgs/
https://www.youtube.com/watch?v=P_5mBPdhLmI

2- https://www.youtube.com/watch?v=lcjDPTkwjrE


26 posted on 09/30/2022 11:27:30 PM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasion, )
[ Post Reply | Private Reply | To 13 | View Replies]

To: Kazan
The Ukrainians will not stop fighting. They hate the Russians in a way Americans simply cannot understand. Their grandfathers continued to fight Stalin into the early 1950s. They aren't going stop, and, being backed by 60% of the world's GDP, they will continue to be adequately armed to continue.

The only way negotiations would start would be if Russia withdrew to its Feb 23 positions. Maybe the Ukrainians would concede Russia's 2014 gains, but that's it.

27 posted on 09/30/2022 11:36:13 PM PDT by pierrem15 ("Massacrez-les, car le seigneur connait les siens" )
[ Post Reply | Private Reply | To 4 | View Replies]

To: Kazan

Obviously you don’t read. It all hinges on the myth you promote here, and this myth, day by day, rings hollow.

Winning is not just pounding on someone, it also is a capacity to rebuild despite being nuked, like Japan and Germany did.

Nuclear war’s destructiveness in itself is also a myth.


28 posted on 09/30/2022 11:37:37 PM PDT by JudgemAll (Democrats Fed. job-security in hates:hypocrites must be gay like us or be tested/crucified)
[ Post Reply | Private Reply | To 4 | View Replies]

To: Zhang Fei

Nice find. Does this guy have a further take after the intervening 6+ months?


29 posted on 09/30/2022 11:52:54 PM PDT by FreedomPoster (Islam delenda est)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Zhang Fei
Uh oh.

Russian forces kidnap Zaporizhzhia NPP director general
— SATURDAY, 1 OCTOBER 2022, 08:00
https://www.pravda.com.ua/eng/news/2022/10/1/7369926/

30 posted on 10/01/2022 12:12:03 AM PDT by familyop ("For they that sleep with dogs, shall rise with fleas" (John Webster, "The White Devil" 1612).)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Zhang Fei

Thanks. Kamil Galeev is writing very interesting threads https://threadreaderapp.com/user/kamilkazani


31 posted on 10/01/2022 1:30:30 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 2 | View Replies]

To: Zhang Fei

Comment at UK Mail
_____________________

BobbyC2022, Salford, United Kingdom, 2 hours ago

The main effect of Putin’s war has been to demonstrate how superior Western liberal democracy is to dictatorship. In the West generals are chosen for military competence. In Russia for loyalty to Putin. Putin’s attack on Ukraine is like Stalin’s attack on Finland in 1939. One million dead Russians and 25,000 dead Finns according to Khrushchev. And for similar reasons. Incompetent leaders. Stalin liquidated the entire professional and competent top military commanders and replaced them with incompetent loyalists. It’s a common problem of p a r a n o i d dictators like Putin and Stalin. Its even worse in the Putin era since Russia is riddled with c o r r u p t i o n from top to bottom. Everyone is on the take. Most of the money that should have gone on military spares has gone into the pockets of the mid-level Russian leaders and officers.


32 posted on 10/01/2022 1:59:24 AM PDT by dennisw
[ Post Reply | Private Reply | To 2 | View Replies]

To: Zhang Fei

Putin could have kept the aura of a powerful Russia and grabbed slices of Ukraine if he hadn’t let hubris get the better of him.


33 posted on 10/01/2022 2:27:56 AM PDT by Cronos
[ Post Reply | Private Reply | To 1 | View Replies]

To: pierrem15

Russia could have win with soft power. But it decided to crush and deny the legitimacy of Ukraine


34 posted on 10/01/2022 2:29:21 AM PDT by Cronos
[ Post Reply | Private Reply | To 27 | View Replies]

To: Zhang Fei

Russia will not lose this war . European economy will collapse . Europe will eventually break away from the USA .


35 posted on 10/01/2022 2:34:05 AM PDT by sushiman
[ Post Reply | Private Reply | To 1 | View Replies]

Russia will not lose the war?


36 posted on 10/01/2022 3:55:36 AM PDT by Gene Eric (Don't be a statist!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: JudgemAll
Nuclear war’s destructiveness in itself is also a myth.

This PSA is brought to you from Moron Central.

37 posted on 10/01/2022 4:27:34 AM PDT by BlackbirdSST (Trump WON!!! The Gestapo closes ranks.)
[ Post Reply | Private Reply | To 28 | View Replies]

To: Zhang Fei

These stood out to me.
To a degree, I hope this is happening in Europe and NATO with its near-death experience of losing Russian energy as winter approaches, and the voters learning that war is not ended in European history, Russia will always be there, threatening.
“Inflicting a painful but not critical defeat on your enemy is risky. Yeah, they kinda became weaker (Ukraine’s 2014 defeat). But the balance of power within them changed. Court politics maxing interest groups lost and efficiency maxing upstarts get a chance”

And this, Ukraine is creating its future and its myth.
“Consider Venice. When Napoleon came they surrendered without a shot. Very smart, saved lives, saved the city. It’s just killed the mythos of Venice. People lived but the Republic died. It was never restored and is unlikely to be restored again
Theorists of war of the bygone age understood it. Clausewitz pointed out that it’s important not only if you lost independence but *how* you lost it. If you submitted without a fight, you saved lives. But you killed your mythos. You’ll be digested by the conqueror
But if you lost after the brutal and bloody fight your mythos is alive. The memory of the last battle will live through the ages. It will shape the mythological space your descendants live in and they’ll attempt to restore independence at the first opportunity. End of thread”


38 posted on 10/01/2022 4:53:59 AM PDT by ansel12 (NATO warrior under Reagan, and RA under Nixon, bemoaning the pro-Russians from Vietnam to Ukraine.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Kazan

“The Russians have already won. Donetsk, Lugansk, Kherson and Zaporizhzhia will never, ever go back to being part of Ukraine.”

Lyman (in Donetsk) was liberated by Ukraine a few hours ago. Your assertion has already been proven wrong.


39 posted on 10/01/2022 5:41:09 AM PDT by Renfrew
[ Post Reply | Private Reply | To 4 | View Replies]

To: sushiman

“European economy will collapse “

Are you aware that the last couple months Natural Gas prices in Europe have been falling? They have succeeded in replacing most of the Russian supply much faster than Putin expected.


40 posted on 10/01/2022 5:43:28 AM PDT by Renfrew
[ Post Reply | Private Reply | To 35 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-79 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson