Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Moscow’s jihadi
The Spectator ^ | 25 June 2011 | Pavel Stroilov

Posted on 08/02/2022 11:54:00 AM PDT by Zhang Fei

What do we know about the new head of al-Qa’eda, Ayman al-Zawahiri? Not very much. We know he’s a former ‘emir’ of the Egyptian Islamic Jihad who spent three years in an Egyptian prison after his group assassinated the pro-western President Anwar Sadat. But there is one curious fact about him that it would be foolish for the West to ignore: his links with the KGB, and its successor, Russia’s Federal Security Service, or FSB.

It was Alexander Litvinenko, the rebel FSB officer assassinated with radioactive material in London in 2006, who named al-Zawahiri as ‘Moscow’s man in al-Qa’eda’. In a interview following the 7 July 2005 attacks in London, he claimed that the future al-Qa’eda chief had stayed in an FSB training centre in Dagestan, in the North Caucasus, in 1998. ‘He took a six-month special training course there. Then he was sent to Afghanistan, where he had never been before. Immediately after that, under supervision of his FSB bosses, he penetrated bin Laden’s entourage and soon became his deputy in al-Qa’eda … I saw those officers from the FSB directorate for Dagestan, who had been training al-Zawahiri shortly before, being reassigned to Moscow and getting promotions.’

Litvinenko repeated this allegation in a number of other interviews. And Ahmed Zakayev, regarded by many as the leader of independent Chechnya’s government-in-exile, finds the claim credible. He told me that ‘a number of emissaries’ came from the Middle East to the North Caucasus to ‘preach global jihad’ after his government made peace with Russia in 1996. ‘All of them spoke Russian, had Russian visas, and travelled through Moscow. Al-Zawahiri is simply the most infamous.’ Moscow, he says, always wanted the Chechens to talk of global jihad rather than independence; it legitimised the war against them.

(Excerpt) Read more at spectator.co.uk ...


TOPICS: Egypt; Extended News; Foreign Affairs; Israel; News/Current Events; Russia; Syria; War on Terror
KEYWORDS: aymanalzawahiri; bloggers; egypt; israel; neocons4biden; paleolibsforputin; putin; russia; syria; ukraine; waronterror; zawahiri
Navigation: use the links below to view more comments.
first 1-2021-25 next last
Old article about the FSB's connections to Zawahiri and international jihad.
1 posted on 08/02/2022 11:54:00 AM PDT by Zhang Fei
[ Post Reply | Private Reply | View Replies]

To: marcusmaximus; Paul R.; Bruce Campbells Chin; PIF; familyop; MercyFlush; tet68; BeauBo; TalBlack; ..

Ukraine ping

Yet another reminder of Russia’s Byzantine intrigues. Yasser Arafat, who mounted numerous terror attacks against American targets, was also a creature of the Russian siloviki.


https://www.jewishvirtuallibrary.org/yasser-arafat-s-kgb-connections
[Before I defected to America from Romania, leaving my post as chief of Romanian intelligence, I was responsible for giving Arafat about $200,000 in laundered cash every month throughout the 1970s. I also sent two cargo planes to Beirut a week, stuffed with uniforms and supplies. Other Soviet bloc states did much the same....

I was given the KGB’s “personal file” on Arafat. He was an Egyptian bourgeois turned into a devoted Marxist by KGB foreign intelligence. The KGB had trained him at its Balashikha special-ops school east of Moscow and in the mid-1960s decided to groom him as the future PLO leader. First, the KGB destroyed the official records of Arafat’s birth in Cairo, replacing them with fictitious documents saying that he had been born in Jerusalem and was therefore a Palestinian by birth.

The KGB’s disinformation department then went to work on Arafat’s four-page tract called “Falastinuna” (Our Palestine), turning it into a 48-page monthly magazine for the Palestinian terrorist organization al-Fatah. Arafat had headed al-Fatah since 1957. The KGB distributed it throughout the Arab world and in West Germany, which in those days played host to many Palestinian students....

Arafat was an important undercover operative for the KGB. Right after the 1967 Six Day Arab-Israeli war, Moscow got him appointed to chairman of the PLO. Egyptian ruler Gamal Abdel Nasser, a Soviet puppet, proposed the appointment. In 1969 the KGB asked Arafat to declare war on American “imperial-Zionism” during the first summit of the Black Terrorist International, a neo-Fascist pro-Palestine organization financed by the KGB and Libya’s Moammar Gadhafi. It appealed to him so much, Arafat later claimed to have invented the imperial-Zionist battle cry. But in fact, “imperial-Zionism” was a Moscow invention, a modern adaptation of the “Protocols of the Elders of Zion,” and long a favorite tool of Russian intelligence to foment ethnic hatred. The KGB always regarded anti-Semitism plus anti-imperialism as a rich source of anti-Americanism....

In March 1978 I secretly brought Arafat to Bucharest for final instructions on how to behave in Washington. “You simply have to keep on pretending that you’ll break with terrorism and that you’ll recognize Israel — over, and over, and over,” Ceausescu told him for the umpteenth time....

Mr. Pacepa was the highest ranking intelligence officer ever to have defected from the former Soviet bloc. The author of “Red Horizons” (Regnery, 1987), he is finishing a book on the origins of current anti-Americanism.]


2 posted on 08/02/2022 11:54:31 AM PDT by Zhang Fei (My dad had a Delta 88. That was a car. It was like driving your living room.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Zhang Fei; AdmSmith; AnonymousConservative; Arthur Wildfire! March; Berosus; Bockscar; BraveMan; ...
Thanks Zhang Fei.

3 posted on 08/02/2022 11:56:37 AM PDT by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
[ Post Reply | Private Reply | To 2 | View Replies]

To: Zhang Fei

So poke Pooh-bah (Xi) and pizz off the Russians all in one week.

Way to go, Brandon!


4 posted on 08/02/2022 12:02:27 PM PDT by lightman (I am a binary Trinitarian. Deal with it!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Zhang Fei

But wasn’t Osama Bin Laden associated with our CIA?


5 posted on 08/02/2022 12:13:47 PM PDT by who_would_fardels_bear (This is not a tagline.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Zhang Fei

Contray to the author’s statement, we knew a great deal about Zawahiri, his brother, his family, his history, at the time the article was written: Including the strongly held belief that he would make Baluchistan, Pakistan, his home.


6 posted on 08/02/2022 12:16:07 PM PDT by Bookshelf
[ Post Reply | Private Reply | To 1 | View Replies]

To: who_would_fardels_bear

[But wasn’t Osama Bin Laden associated with our CIA?]


In a word, no. Uncle Sugar did help Russia throw the German hordes back with copious supplies. In gratitude, the Russians helped kill 100,000 GI’s in Korea and Vietnam by providing North Korea and North Vietnam with large amounts of military equipment.


7 posted on 08/02/2022 12:27:49 PM PDT by Zhang Fei (My dad had a Delta 88. That was a car. It was like driving your living room.)
[ Post Reply | Private Reply | To 5 | View Replies]

To: Zhang Fei

More about the start of the Palestinians here “SOVIET RUSSIA, THE CREATOR OF THE PLO AND THE PALESTINIAN PEOPLE” by Wallace Edward Brand https://www.readcube.com/articles/10.2139/ssrn.2387087


8 posted on 08/02/2022 12:40:00 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 2 | View Replies]

To: AdmSmith

... and here is one of the architects of this https://en.wikipedia.org/wiki/Yevgeny_Primakov


9 posted on 08/02/2022 12:46:53 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8 | View Replies]

To: Zhang Fei

You are right on Zhang Fei !

There is much material on this, as well as past and current related efforts.

I know you are “taking it easy” here, as there is much more documented history, past to present.

From Experience —

Through at least the first half of the 1990’s, as they were not recognized as a nation, Israel was not allowed to have a Consulate in Moscow.

The PLO had for decades, from the time of the Moscow involved/organized Arab League.

As I had spent most of a decade in Moscow, as an aside, I (and other Americans) received request to teach modern history (”From the American Perspective”), as well as economics and finance.

To qualify, we had to pass a course on World History from the Russian (Stalinist rewritten) perspective. Many don’t know this, but Stalin had upward of 6,000 individuals employed to rewrite mosyly modern world history. They also received funding from Western publishers of school curricula.

Think about that...

Again, not the purpose of being there, but one of the schools I accepted an invitation to teach was affiliated with two universities in Israel, and was located in an actual WWII Ghetto (still walled, but with no modern gates on the roads in and out). Upon learning I was teaching (on the side) in the Cetral East Moscow ghetto, the Russian ministry of interior protested to the Embassy, and formally tried to get me removed from Russia. The FSB general who was behind it made a lot of trouble.

Russians officials who were supposed to work with me, (some on a RIA Novosti “good will project”) were harassed and became scared to associate with myself and others. Several of the Jewish students (who were not allowed to attend MS University because they were Jewish (and parents not part of the ruling elite) came up missing. We had parents reaching out to the US government for help soon after. A few of the Jewish students were poisoned to death. One was thrown off a 17h floor balcony by uniformed “mee~litsia”, and we were informed right before a class. But Clinton’s people would only ever acquiesce to the FSB demands guiding Yeltsin. While not alone, we soon stopped teaching in the ghetto, as we knew people were really getting hurt because of us.

I could go on all day with related and informative info.

In addition to what you have posted, remember this —

The last time Israel fought Moscow

https://youtu.be/noXPLL7pyfU


10 posted on 08/02/2022 12:47:19 PM PDT by patriotfury ((May the fleas of a thousand camels occupy mo' ham mads tents!) )
[ Post Reply | Private Reply | To 2 | View Replies]

To: who_would_fardels_bear

“ But wasn’t Osama Bin Laden associated with our CIA?”
*************************************************

Come on, don’t be a party pooper. You’re going to spoil the RUSSIA, RUSSIA, RUSSIA party narrative.


11 posted on 08/02/2022 12:47:48 PM PDT by House Atreides (I’m now ULTRA-MAGA-PRO-MAX!)
[ Post Reply | Private Reply | To 5 | View Replies]

To: patriotfury; All

Again, I apologize for the several mistakes above.


12 posted on 08/02/2022 12:49:35 PM PDT by patriotfury ((May the fleas of a thousand camels occupy mo' ham mads tents!) )
[ Post Reply | Private Reply | To 10 | View Replies]

To: Zhang Fei

The Frankenstein the CIA created:

https://www.theguardian.com/world/1999/jan/17/yemen.islam

“American officials estimate that, from 1985 to 1992, 12,500 foreigners were trained in bomb-making, sabotage and urban guerrilla warfare in Afghan camps the CIA helped to set up.”

“Since the fall of the Soviet puppet government in 1992, another 2,500 are believed to have passed through the camps. “

“The point is that we created a whole cadre of trained and motivated people who turned against us. It’s a classic Frankenstein’s monster situation.”

” Al-Zawahiri ran his own operation during the Afghan war, bringing in and training volunteers from the Middle East. Some of the $500 million the CIA poured into Afghanistan reached his group.”

Note: this last quote is referring to the predecessor of the guy discussed in the article for this thread.


13 posted on 08/02/2022 12:51:05 PM PDT by Mount Athos
[ Post Reply | Private Reply | To 1 | View Replies]

To: who_would_fardels_bear

“But wasn’t Osama Bin Laden associated with our CIA?”

Short answer -

NO.

Due to at one point having nearly 55,000 nuclear warheads aimed at us, and as the CCCP architecture and goal was to take Marxist Communism global, and to control the global communist government from Moscow, our policy was as you know, one of of Soviet Socialist containment.

As such, we did work with the Taliban.

We worked with a number organizations and characters who flipped back and forth, both with us and against us, in jurisdictions around the world.

However, OBL was not one of them.


14 posted on 08/02/2022 1:05:04 PM PDT by patriotfury ((May the fleas of a thousand camels occupy mo' ham mads tents!) )
[ Post Reply | Private Reply | To 5 | View Replies]

To: patriotfury
As such, we did work with the Taliban.

Soviets left Afghanistan in February 15, 1989. In September 1994, Mullah Mohammad Omar and 50 students founded the Taliban in his hometown of Kandahar.

15 posted on 08/02/2022 1:35:21 PM PDT by tlozo (Better to Die on Your Feet than Live on Your Knees)
[ Post Reply | Private Reply | To 14 | View Replies]

To: Zhang Fei

It is worth mentioning that Litvikenoo was a Muslim convert, a mole of both MI6 and Al-Qaeda.


16 posted on 08/02/2022 2:11:03 PM PDT by NorseViking
[ Post Reply | Private Reply | To 1 | View Replies]

To: tlozo

You are of course correct.

My statement -

“As such, we did work with the Taliban.”

Would be more correct if I had stated *mujahideen*, which would spawn the Taliban.

Pashto Ṭālebān, or “Students”, were the ultra religious political faction identified in Afghanistan really between 1992-1994.

As you stated and eluded, this followed the withdrawal of Soviet troops, the collapse of Moscows communist Afghan government, and really the continued spiralling breakdown of order.

Unofficially, it began its rise to power well before 1992.

As I am sure you know, the sanitized version is it began as a small group of religious students and scholars Pashto/Ṭālebān, seeking to stop or control crime and corruption, with goals of greater

The rise of the Taliban’s is attributed the vacuum from the 1978–92 Afghan war.

Outside of Kabul, Afghanistan’s government was virtually powerless.

Because of bloody chaos from thuglords, mujahidern’s rhetoric became popular.

In 1994, mujahideen fighters from the 1978-1992 war, from a madrasah in Kandahār, quickly rose in strength, control, and popularity, and would pretty quickly act to seize everything, including people.


17 posted on 08/02/2022 3:00:22 PM PDT by patriotfury ((May the fleas of a thousand camels occupy mo' ham mads tents!) )
[ Post Reply | Private Reply | To 15 | View Replies]

To: tlozo

You are of course correct.

My statement -

“As such, we did work with the Taliban.”

Would be correct if I had stated *mujahideen* which would spawn the Taliban.

Pashto Ṭālebān, or “Students”, were the ultra religious political faction identified in Afghanistan really between 1992-1994.

As you stated and eluded, this followed the withdrawal of Soviet troops, the collapse of Moscows communist Afghan government, and really the continued spiralling breakdown of order.

Unofficially, it began its rise to power well before 1992.

As I am sure you know, the sanitized version is it began as a small group of religious students and scholars Pashto/Ṭālebān, seeking to stop or control crime and corruption, with goals of greater power.

The rise of the Taliban is attributed the vacuum from the 1978–92 Afghan war.

Outside of Kabul, Afghanistan’s government was virtually powerless.

Because of bloody chaos from thuglords, mujahidern’s rhetoric became popular.

In 1994, mujahideen fighters from the 1978-1992 war, from a madrasah in Kandahār, quickly rose in strength, control, and popularity, and would pretty quickly act to seize everything, including people.


18 posted on 08/02/2022 3:05:34 PM PDT by patriotfury ((May the fleas of a thousand camels occupy mo' ham mads tents!) )
[ Post Reply | Private Reply | To 15 | View Replies]

To: patriotfury; Zhang Fei; familyop

“As such we did work with the Taliban.”

A classic case of applying “the enemy of my enemy is my friend.” Unfortunately, the Saudis sponsor Madrasas (Islamic religious schools) in a number of places that only teach an extremely conservative brand of Islam, with no other significant learning made available.

Here is an AOL sample of how the US media view this event: https://www.aol.com/news/explainer-al-zawahri-why-did-010019778-114023565.html


19 posted on 08/02/2022 5:01:11 PM PDT by gleeaikin (Question authority)
[ Post Reply | Private Reply | To 14 | View Replies]

To: Zhang Fei
For reference, a primer on the Silovik.
20 posted on 08/03/2022 12:08:42 AM PDT by Widget Jr (Disobey your television.)
[ Post Reply | Private Reply | To 2 | View Replies]


Navigation: use the links below to view more comments.
first 1-2021-25 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson