Free Republic
Browse · Search
News/Activism
Topics · Post Article

The Coronavirus is apparently EXTREMELY contagious via several mediums of transmission. How do you stop that? Hmmm???

This will kill ebay sales from goods from China and Asia. Uh oh...

1 posted on 02/15/2020 9:11:29 AM PST by MeneMeneTekelUpharsin
[ Post Reply | Private Reply | View Replies ]


To: MeneMeneTekelUpharsin; neverdem; ProtectOurFreedom; Mother Abigail; EBH; vetvetdoug; Smokin' Joe; ..
Filthy lucre not allowed!
Bring Out Your Dead

Post to me or FReep mail to be on/off the Bring Out Your Dead ping list.

The purpose of the “Bring Out Your Dead” ping list (formerly the “Ebola” ping list) is very early warning of emerging pandemics, as such it has a high false positive rate.

So far the false positive rate is 100%.

At some point we may well have a high mortality pandemic, and likely as not the “Bring Out Your Dead” threads will miss the beginning entirely.

*sigh* Such is life, and death...

If a quarantine saves just one child's life, it's worth it.

2 posted on 02/15/2020 9:15:53 AM PST by null and void (The democrats just can't get over the fact that they lost an election they themselves rigged!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: null and void

Disinfecting the currency? What does this tell us? That disease lives a long time on the surface of things.


3 posted on 02/15/2020 9:15:56 AM PST by MeneMeneTekelUpharsin (Freedom is the freedom to discipline yourself so others don't have to do it for you.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: MeneMeneTekelUpharsin

Why don’t these scare articles ever mention the number who have recovered?

It’s 8,580 as of this posting.

https://gisanddata.maps.arcgis.com/apps/opsdashboard/index.html#/bda7594740fd40299423467b48e9ecf6


6 posted on 02/15/2020 9:17:02 AM PST by Moonman62 (Charity comes from wealth.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: MeneMeneTekelUpharsin

I guess China is officially acknowledging that they launder money.


7 posted on 02/15/2020 9:17:55 AM PST by rigelkentaurus
[ Post Reply | Private Reply | To 1 | View Replies ]

To: MeneMeneTekelUpharsin

Wow, now they are on fool’s errands. How many times does a bill change hands before it finds its way back to a bank?

In the US, it is said a $1 or $5 bill changes hands on average about 110 times per year. That’s just less than ten times per month or a new “owner” every three days. I guess bills spend a lot of time in wallets, ATM machines, store tills.

Can bills really be a major vector?

Maybe they will require every store to send every bill every night to a bank for disinfecting.


11 posted on 02/15/2020 9:19:33 AM PST by ProtectOurFreedom
[ Post Reply | Private Reply | To 1 | View Replies ]

To: MeneMeneTekelUpharsin

The virus, which has infected 66,492 people in China...

...

There are 1.382 billion people in China who are not infected.


21 posted on 02/15/2020 9:24:16 AM PST by Moonman62 (Charity comes from wealth.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: MeneMeneTekelUpharsin
Thanks for the post. I watched the video and question how effective their UVC method is, however it is good they are packing up the money (fomites) for 14 days.

I'm sure the flu bros will tell us this is a panic reaction. LOL.
36 posted on 02/15/2020 9:37:05 AM PST by PA Engineer (Liberate America from the Occupation Media.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: MeneMeneTekelUpharsin

What about the little number buttons everyone has to punch their code into at stores? Which is dirtier, cash or hundreds of people touching those filthy buttons every day in stores everywhere?


45 posted on 02/15/2020 10:11:30 AM PST by 444Flyer (John 3 Revelation 20 Joshua 24:15 Pick a side..)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: MeneMeneTekelUpharsin

Wouldn’t irradiating items, cash, mail etc etc have the same disinfecting effect as irradiating food does ?


52 posted on 02/15/2020 10:24:13 AM PST by redcatcherb412
[ Post Reply | Private Reply | To 1 | View Replies ]

To: MeneMeneTekelUpharsin; Liz
China disinfects BANK NOTES and quarantines them for 14 days...

Amazon needs to do the same with packages and banks need to flood ATM machines (after each use) with ultraviolet...

And most of all - the Post Office... Before they hand out mail to their carriers... and give the virus to the rest of us...

67 posted on 02/15/2020 11:25:34 AM PST by GOPJ ( http://www.tinyurl.com/cvirusmap https://www.cdc.gov/flu/weekly/usmap.htm)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: MeneMeneTekelUpharsin

Hmmmm. New money is never a good sign.


76 posted on 02/15/2020 2:04:11 PM PST by tet68 ( " We would not die in that man's company, that fears his fellowship to die with us...." Henry V.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: MeneMeneTekelUpharsin

Filthy Communist country, filthy Communist money.


78 posted on 02/15/2020 2:39:35 PM PST by Starcitizen (American. No hypenation necessary. Send the H1B and H4EAD slime home. American jobs for Americans)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: MeneMeneTekelUpharsin; nuconvert; AmericanInTokyo; SunkenCiv

This could as well be a way to increase M1, i.e the currency in circulation, to try to avoid a Chinese recession.


82 posted on 02/16/2020 10:01:43 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson