Skip to comments.
Chinese cruise passengers put patriotism above tourism by skipping South Korean port visit
The Star ^
| 14 March 2017
Posted on 03/14/2017 6:36:41 AM PDT by TigerLikesRooster
Chinese cruise passengers put patriotism above tourism by skipping South Korean port visit
SHANGHAI (Reuters) - When the Costa Serena cruise ship steamed into the South Korean tourist island of Jeju, Bai Liyun stayed on board, where crew had organised a magic show, games and even a wine-tasting.
She was not alone.
Most of her Chinese shipmates, estimated by passengers to number more than 3,000, followed suit, in a show of solidarity with their government's vociferous opposition to South Korea's decision to deploy a controversial missile defence system.
"We spent the whole day on the cruise ship. I felt very happy," Bai, from China's western province of Gansu, said on Tuesday in Shanghai, where the passengers disembarked on their return.
"As Chinese, we surely should answer the government's call at a special time, which meant not going to Jeju Island."
But the decision meant tour guides and about 80 tour buses were left waiting at the port, South Korean media reported.
China has publicly opposed the deployment of the Terminal High Altitude Area Defence (THAAD) missile system, calling its powerful radar a threat to the country's security.
However, South Korea and the United States say the system is aimed solely at defending the South against a growing North Korean missile threat.
Nevertheless, Beijing has stepped up pressure on companies doing business with, and in, South Korea, although it has not directly said it was targeting South Korean firms in retaliation.
The stakes are high for South Korea, and tourism is a particularly vulnerable sector. South Korean data show almost half of its visitors come from China.
Last week, airlines such as China Eastern Airlines Corp Ltd and Spring Airlines Co Ltd stopped website offers of flights between China's eastern city of Ningbo and Jeju.
(Excerpt) Read more at thestar.com.my ...
TOPICS: Foreign Affairs; News/Current Events
KEYWORDS: china; skorea; thaad
To: TigerLikesRooster; AmericanInTokyo; Steel Wolf; nuconvert; MizSterious; endthematrix; ...
Video: Chinese woman damages and eats goods at Korean supermarket in the name of patriotism
14 March 2017 16:48 Catherine Lai3 min read
A video has surfaced of a Chinese woman damaging goods and eating snacks without paying at Korean supermarket chain Lotte Mart.
In the clip, she crushes packages of snacks, eats cookie sticks, opens packages of instant noodles, and drinks from containers before putting them back on the shelves.
The Korean retailer is caught in the crossfire over Chinas displeasure at the deployment of the US militarys THAAD antimissile system. Protests have sprung up in front of its stores, its products have been pulled from Chinese shopping sites, business partners have pulled out, and boycott calls have emerged online.
Video footage of the womans escapades were set to the patriotic song Chinese people by Cantonese singer Andy Lau. At the end of the clip, she stands in front of the supermarket entrance while holding up her middle fingers.
https://youtu.be/ryiBuRILHX4
The video was originally uploaded to live streaming platform Kuaishou. It subsequently took down the video and issued a notice on its Weibo account on Sunday which said that it has collected the evidence and all information about the user and handed the matter over to police.
The Kuaishou users profile said she was a young woman living in Shenyang, with 110 videos and over 5,000 fans. She livestreams every evening at 6pm, according to screenshots posted by Weibo users.
Brainless
Commentators on Weibo reposts of the video criticised her actions as stupid and called her brainless. One said she must have wanted to go viral so badly that she lost her mind, and another said, simply: boycott fools.
The Shenyang cybersecurity police said on its official Weibo account that they are aware of the case and are handling it.
One verified Weibo account belonging to a police officer with the cybersecurity unit in Shenyang said: Patriotism is rational. Some people who use the name of patriotism to do things that discredit the country are either stupid or bad!
Lotte signed a land use deal with the South Korean military on February 28 which allowed the military to use a golf course it owns to store a THAAD battery. The US and South Korea say the system is intended to protect South Korea from attacks against North Korea, but China fears it could be used against it, saying that it resolutely opposes the deployment.
State news agency Xinhua has been criticising the retailers decision since mid-February, calling it akin to assisting a bloodthirsty tiger. Nationalistic tabloid Global Times called for a boycott in an editorial.
Lotte said last Wednesday that 55 of its Lotte Mart stores have been ordered to stop running temporarily more than half of the 99 stores it currently operates in China, according to the publicly-funded Yonhap News Agency.
Another video of a woman rapping about Lotte, calling it a dog that ignores the feelings of its master and saying that she does not need South Korean cosmetic products was slammed by the Global Times on Tuesday. The tabloid said that the boycott is a very serious matter and that the online entertainer is discrediting patriotism.
2
posted on
03/14/2017 6:44:56 AM PDT
by
TigerLikesRooster
(dead parakeet + lost fishing gear = freep all day)
To: TigerLikesRooster
South Korea should just sit quietly awaiting annihilation by that crazed little ball of fat.
3
posted on
03/14/2017 6:46:38 AM PDT
by
HomerBohn
(Liberals and Slinkys are similar in that thorwing them down the stairs brings a smile to your face.)
To: TigerLikesRooster
That’s how wars get started. South Korea is not stupid.
4
posted on
03/14/2017 6:47:14 AM PDT
by
DIRTYSECRET
(urope. Why do they put up with this.)
To: TigerLikesRooster; Army Air Corps; gaijin; lefty-lie-spy
Ping >:(
I wish I could visit Jeju sometime.
5
posted on
03/14/2017 6:52:28 AM PDT
by
KC_Lion
("We must put our citizens first. Only then will we Make America Great Again."- Donald Trump)
To: TigerLikesRooster
I wonder what would have happened if any passenger had dared to express a dissenting view.
To: TigerLikesRooster
The people and governments of South Korea have always been naive when it comes to China. They ignore their peninsula’s history vis-a-vis China. The new emperors have drugged South Korea with huge openings of trade, just to use that as a means of control, threatening to remove the drug if South Korea does not kowtow to the emperors.
7
posted on
03/14/2017 7:16:00 AM PDT
by
Wuli
To: KC_Lion
That’s where they used to have ROC Ranger school.
To: TigerLikesRooster
Yoy think they had a choice?
To: TigerLikesRooster
Do the Chinese cruise ships have one watcher for each tourist, to prevent defections?
10
posted on
03/14/2017 8:04:38 AM PDT
by
JimRed
( TERM LIMITS, NOW! Building the Wall! TRUTH is the new HATE SPEECH.)
To: TigerLikesRooster
How horrible that Koreans want to defend themselves...
11
posted on
03/14/2017 8:05:13 AM PDT
by
American in Israel
(A wise man's heart directs him to the right, but the foolish mans heart directs him toward the left.)
To: TigerLikesRooster
Based on my experience with Chinese tourists in US National Parks, I’d say S. Korea came out ahead.
12
posted on
03/14/2017 8:33:09 AM PDT
by
mesoman7
To: TigerLikesRooster
Apparently they’ve also stopped showing KDramas in China, which were very popular, especially “Descendants of the Sun.”
13
posted on
03/14/2017 8:34:42 AM PDT
by
dfwgator
To: KC_Lion
We made it to Busan at the tail end of a cruise a few years ago. Some impressive infrastructure.. we should be so lucky to have a people that works that hard.
SKoreans deserve better than to be periodically abused by China and Japan and NK, well, most SKoreans anyway. ;-)
14
posted on
03/14/2017 8:49:41 AM PDT
by
NormsRevenge
(Semper Fi - Monthly Donors Rock!!!)
To: TigerLikesRooster
15
posted on
03/14/2017 8:51:04 AM PDT
by
AdmSmith
(GCTGATATGTCTATGATTACTCAT)
To: NormsRevenge
Jeju Island was featured prominently in the KDrama “Secret Garden”, looks like the kind of place I’d like to see someday.
16
posted on
03/14/2017 9:01:34 AM PDT
by
dfwgator
To: TigerLikesRooster
Very simple explanation:Had they disembarked, they knew a gun would be pointed at their heads when they returned to China.
17
posted on
03/14/2017 9:21:47 AM PDT
by
TXnMA
(Remember the Alamo! Remember Goliad! REPEAT San Jacinto!!!)
To: dfwgator
![](http://2.bp.blogspot.com/-4SWntCnIr4Q/TduM7E0M28I/AAAAAAAAANU/ylazkhgM-aQ/s1600/bof21c.jpg)
Also Boys over Flowers
18
posted on
03/14/2017 11:04:41 AM PDT
by
fishtank
(The denial of original sin is the root of liberalism.)
To: fishtank
I’ve heard a lot about that one, never watched it.
Actually I just finished “A Gentleman’s Dignity”. It may be my new all-time favorite.
19
posted on
03/14/2017 11:06:24 AM PDT
by
dfwgator
To: TigerLikesRooster
If the Chinese did not stay on board they would be killed once back in China.
Disclaimer:
Opinions posted on Free Republic are those of the individual
posters and do not necessarily represent the opinion of Free Republic or its
management. All materials posted herein are protected by copyright law and the
exemption for fair use of copyrighted works.
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson