Skip to comments.
Russian Orthodox Church Lends Weight To Putin patriotism
BBC News ^
| 8/20/2015
| Vitaly Shevchenko
Posted on 08/21/2015 12:59:10 AM PDT by goldstategop
A raid by Russian Orthodox vigilantes on "blasphemous" artworks in central Moscow has highlighted the influence of traditional, ultra-conservative values in President Vladimir Putin's Russia.
The Orthodox Church has long had close links to the Kremlin. And during Russia's stand-off with the West over Ukraine that relationship has only grown stronger.
On 14 August a radical group called God's Will raided an exhibition of Soviet-era underground art at the Manezh hall, near the Kremlin.
They especially objected to avant-garde depictions of Jesus Christ and Orthodox saints - a video posted online showed them throwing exhibits onto the floor and shouting "You can't offend Christ like that!"
(Excerpt) Read more at bbc.com ...
TOPICS: Culture/Society; Foreign Affairs; News/Current Events; Russia
KEYWORDS: conservatism; crimea; donetsk; imperialism; imperialists; orthodoxchurch; presidentputin; putinsbuttboys; russia; russianstooges; thugs; ukraine; vigilantes; vladtheimploder
Navigation: use the links below to view more comments.
first 1-20, 21-22 next last
The values of the West such as its contempt for religion and its embrace of same sex marriage find no reception in Russia.
Those are not my values and I understand why they think we are corrupt and decadent.
To: goldstategop
The values of the West such as its contempt for religion and its embrace of same sex marriage find no reception in Russia. Those are not my values and I understand why they think we are corrupt and decadent. Considering only 7 percent of Russians even attend church, and that same church is run by a "former" KGB agent worth millions that cares more about nationalism and rewriting history, all of this is really just a sick joke.
By the way, the Russian military is notorious for homosexual rape/hazing, evne forced prostitution.
To: goldstategop
Post Soviet Russia:

A Russian Orthodox Priest Blesses A Fighter Jet
3
posted on
08/21/2015 1:02:09 AM PDT
by
goldstategop
(In Memory Of A Dearly Beloved Friend Who Lives In My Heart Forever)
To: goldstategop; Gamecock; SaveFerris; FredZarguna
The Latvian Orthodox have better hats.
To: goldstategop
Shoot, they have blessed nuclear-tipped ICBM’s.
5
posted on
08/21/2015 1:18:28 AM PDT
by
SaveFerris
(Be a blessing to a stranger today for some have entertained angels unaware)
To: goldstategop
Theocracy, even for devout Christians, is offensive because we cannot coerce people to sincerely believe in Christ.
6
posted on
08/21/2015 1:29:41 AM PDT
by
elhombrelibre
(Against Obama. Against Putin. Pro-freedom. Pro-US Constitution.)
To: goldstategop
Russia’s complex entanglement with communism totally subordinates its virtues.
7
posted on
08/21/2015 2:05:54 AM PDT
by
Gene Eric
(Don't be a statist!)
To: goldstategop; Greetings_Puny_Humans
The Kremlins Troll Army: Moscow is financing legions of pro-Russia Internet commenters:
A June article by Max Seddon of BuzzFeed reported the Kremlin was spending millions of dollars to pay English-speaking Russians to promote President Vladimir Putin and his policies in U.S. media like Fox News broadcasting and The Huffington Post and Politico news sites. Trolls are reportedly expected to manage multiple fake accounts and post on news articles 50 times a day, often with sentiments as simplistic as Putin makes Obama look stupid and weak!
http://www.theatlantic.com/international/archive/2014/08/the-kremlins-troll-army/375932/
____________________________
Documents Show How Russias Troll Army Hit America:
http://www.buzzfeed.com/maxseddon/documents-show-how-russias-troll-army-hit-america
____________________________
Trolls are reportedly expected to manage multiple fake accounts and post on news articles 50 times a day, often with sentiments as simplistic as Putin makes Obama look stupid and weak!...
They do this only in an attempt to win the trust of anti-Obama folks -- a clever/sneaky way to add credibility to their pro-Russia, pro-Putin BS. Yet it seems to work on some of us! In reality, Obama is the best thing that has happened to Russia in a long time.
____________________________
8
posted on
08/21/2015 2:07:05 AM PDT
by
ETL
(ALL (most?) of the Obama-commie connections at my FR Home page: http://www.freerepublic.com/~etl/)
To: goldstategop; Greetings_Puny_Humans
9
posted on
08/21/2015 2:08:10 AM PDT
by
ETL
(ALL (most?) of the Obama-commie connections at my FR Home page: http://www.freerepublic.com/~etl/)
To: goldstategop; Greetings_Puny_Humans
KGB Putin thinks the COLLAPSE of the mass-murdering communist Soviet Union was the 'greatest geopolitical catastrophe' of the 20th century

"the greatest geopolitical catastrophe of the [20th] century" -Russian leader Vladimir Putin on the collapse of the Soviet Union...
"World democratic opinion has yet to realize the alarming implications of President Vladimir Putin's State of the Union speech on April 25, 2005, in which he said that the collapse of the Soviet Union represented the 'greatest geopolitical catastrophe of the century.'
http://www.hoover.org/research/putins-russia-stalin-lite
____________________________________________________

"'The Black Book of Communism,'; a scholarly accounting of communisms crimes, counts about 94 million murdered by the supposed champions of the common man (20 million for the Soviets alone), and some say that number is too low."
Forgetting the Evils of Communism: The amnesia bites a little deeper
By Jonah Goldberg, August 2008:
http://web.archive.org/web/20090228095645/http://article.nationalreview.com/?q=ZmY0MjI1MDgyYjg1M2UwNDMzMTk2Mjk5YTk0ZTdlMWE=
____________________________________________________
"Stalin deserves statues in his honor"--Vladimir Putin
http://en.ria.ru/russia/20131219/185734707/Putin-Says-Stalin-No-Worse-Than-Cunning-Oliver-Cromwell.html

____________________________________________________
From a 2007 article titled "Putin's Russia"...
"KGB influence 'soars under Putin,' " blared the headline of a BBC online article for December 13, 2006. The following day, a similar headline echoed a similarly alarming story at the website of Der Spiegel, one of Germany's largest news magazines: "Putin's Russia: Kremlin Riddled with Former KGB Agents."
In the opening sentences of Der Spiegel's article, readers are informed that: "Four out of five members of Russia's political and business elite have a KGB past, according to a new study by the prestigious [Russian] Academy of Sciences. The influence of ex-Soviet spies has ballooned under President Vladimir Putin."
The study, which looked at 1,061 top Kremlin, regional, and corporate jobs, found that "78 percent of the Russian elite" are what are known in Russia as "siloviki," which is to say, former members of the KGB or its domestic successor, the FSB. The author of the study, Olga Kryshtanovskaya, expressed shock at her own findings. "I was very shocked when I looked at the boards of major companies and realized there were lots of people who had completely unknown names, people who were not public but who were definitely, obvious siloviki," she told Reuters.
Other supposed experts in Russia and the West have also expressed surprise and alarm at the apparent resurrection of the dreaded Soviet secret police. After all, for the past decade and a half these same experts have been pointing to the alleged demise of the KGB as the primary evidence supporting their claim that communism is dead.
From the Bolshevik Revolution in 1917, the Russian security apparatus Cheka (and its later permutations: OGPU, NKVD, MGB, KGB) had been the "sword and shield" of the communist world revolution.
"We stand for organized terror," declared Felix Dzerzhinsky, the first chief of the Cheka for Soviet dictator Vladimir Lenin. In 1918, Dzerzhinsky launched the campaign of arrests and executions known as the Red Terror. Krasnaya Gazeta, the Bolshevik newspaper, expressed the Chekist credo when it reported approvingly in 1918 of the terror campaign: "We will make our hearts cruel, hard and immovable, so that no mercy will enter them, and so that they will not quiver at the sight of a sea of enemy blood."
Unflinching cruelty and merciless, bloody terror have been the trademark of the communist secret police, from the Cheka to the KGB. Obviously, the demise of such an organization would be cause for much rejoicing. Hence, when the KGB was ordered dissolved and its chairman, General Vladimir Kryuchkov, was arrested in 1991 after attempting to overthrow "liberal reformer" Mikhail Gorbachev in the failed "August Coup," many people in the West were only too willing to pop the champagne corks and start celebrating our supposed victory over the Evil Empire.
But, as Mikhail Leontiyev, commentator for Russia's state-controlled Channel One television, recently noted, repeating a phrase popular among the siloviki: "Americans got so drunk at the USSR's funeral that they're still hung over." And stumbling around in their post-inebriation haze, many of these Americans have only recently begun noticing that they had prematurely written the KGB's epitaph, even as it was arising vampire-like from the coffin.
However, there is really no excuse for Olga Kryshtanovskaya or any of her American counterparts to be stunned by the current siloviki dominance in Putin's Russia. For nearly a decade, even before he became Russia's "president," THE NEW AMERICAN has been reporting on Putin's KGB pedigree and his steady implementation of a long-range Soviet deception strategy, including the public rehabilitation and refortifying of the KGB-FSB. ..." (continues at link)
http://www.thenewamerican.com/world-news/europe/item/8420-putins-russia
____________________________________________________
2008...





10
posted on
08/21/2015 2:17:39 AM PDT
by
ETL
(ALL (most?) of the Obama-commie connections at my FR Home page: http://www.freerepublic.com/~etl/)
To: goldstategop
Example of the “ values” of the head of the Russian Orthodox Church
“The head of the Russian Orthodox Church has awarded Communist Party leader Gennady Zyuganov with an order for glory and honor. Patriarch Kirill gave the order to Zyuganov in Moscow on June 27, one day after the longtime communist leader celebrated his 70th birthday.
Kirill said Zyuganov who in 2010 called for the re-Stalinization of Russia and has called the Soviet Union the most humane state in human history deserves the award as one of the most famous Russian politicians who has expressed interest in the welfare of the nation and the protection of traditional moral values.
11
posted on
08/21/2015 2:25:17 AM PDT
by
Kozak
(Walker / Cruz 2016 or Cruz/ Walker 2016 Either one is good...)
To: Kozak
Russians are masters at the complex game of chess, while most of us, unfortunately, suck at simple checkers. Some wouldn’t even know how to set up the board for a game of checkers.
12
posted on
08/21/2015 2:34:15 AM PDT
by
ETL
(ALL (most?) of the Obama-commie connections at my FR Home page: http://www.freerepublic.com/~etl/)
To: ETL
It is not much mentioned in the US media, but the lifting of the UN sanctions opens the door for Iran to become a full member of the Shanghai Cooperation Organization(SCO). Iran has long held observer status in SCO and sponsored by Russia for full membership. It is also said that Pakistan and India will also soon become full members in SCO.
Iran also has the potential to become a member of the Russian led Collective Security Treaty Organization.
Bear, Dragon, and Eagle: Russian, Chinese, and U.S. Military Strategies
To: goldstategop
Another blessing of a warplane, where you can see who their saint is. Recognize him?
14
posted on
08/21/2015 2:57:50 AM PDT
by
Krosan
To: goldstategop
Yes and that is why Putin uses the Church against the West
15
posted on
08/21/2015 4:32:12 AM PDT
by
ballplayer
(hvexx NKK c bmytit II iyijjhihhiyyiyiyi it iyiiy II i hi jiihi ty yhiiyihiijhijjyjiyjiiijyuiiijihyii)
To: AdmSmith; AnonymousConservative; Berosus; bigheadfred; Bockscar; cardinal4; ColdOne; ...
IOW, the vigilantes serve the atheist commie thug at the head of the criminal syndicate running Russia.
16
posted on
08/21/2015 10:37:48 AM PDT
by
SunkenCiv
(What do we want? REGIME CHANGE! When do we want it? NOW)
To: Greetings_Puny_Humans; SunkenCiv; Kozak; ETL
As the Russian economy reels from low oil prices and Western sanctions, the country is seeing rising interest in unorthodox financial solutions, most recently one pitched by the Orthodox Church.
Last week, the Russian Chamber of Commerce and Industry threw its support behind a so-called Orthodox Financial System developed under the aegis of the Moscow Patriarchate and strongly resembling the better known Islamic financial system.
http://www.pravoslavie.ru/english/81504.htm
This will increase their poverty.
17
posted on
08/21/2015 11:57:53 PM PDT
by
AdmSmith
(GCTGATATGTCTATGATTACTCAT)
To: AdmSmith
From your link.
“The introduction of Islamic banking to Russia was cheered by the head of Russia’s state-owned bank Sberbank, German Gref, who called it a very important instrument amid the current problems with raising funds on international markets, Interfax reported in May.
Last month, Sberbank and the republic of Tatarstan signed an agreement on cooperation in the field of Islamic financing, Sberbank said in a press release.”
Is this insanity or a desperate ploy to get some Islam oil money?
18
posted on
08/22/2015 3:36:03 AM PDT
by
Krosan
To: AdmSmith
19
posted on
08/22/2015 12:29:38 PM PDT
by
SunkenCiv
(What do we want? REGIME CHANGE! When do we want it? NOW)
To: Krosan
20
posted on
08/23/2015 1:17:16 AM PDT
by
AdmSmith
(GCTGATATGTCTATGATTACTCAT)
Navigation: use the links below to view more comments.
first 1-20, 21-22 next last
Disclaimer:
Opinions posted on Free Republic are those of the individual
posters and do not necessarily represent the opinion of Free Republic or its
management. All materials posted herein are protected by copyright law and the
exemption for fair use of copyrighted works.
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson