Free Republic
Browse · Search
News/Activism
Topics · Post Article


1 posted on 07/16/2015 4:40:06 PM PDT by Krosan
[ Post Reply | Private Reply | View Replies ]


To: Krosan

There is so much information and misinformation about MH17 that I don’t know what to believe.


2 posted on 07/16/2015 4:44:19 PM PDT by BBell
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Krosan; Admin Moderator

Sorry. Forgot to indicate that there is a video when you click. Admin Moderator, could you please help to fix it? Perhaps put [video at link] into title?


4 posted on 07/16/2015 4:52:46 PM PDT by Krosan
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Krosan

I wish they didn’t pixelate the IDs. That’s the proof.


5 posted on 07/16/2015 5:10:03 PM PDT by proust (Can't stump the Trump!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Krosan

I bet that guy taking clothes out of that bag was TSA.


8 posted on 07/16/2015 5:12:06 PM PDT by Veggie Todd (The tree of liberty must be refreshed from time to time with the blood of patriots and tyrants. TJ)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Krosan
.....ransacking the luggage of passengers and crew.....

стервятник - stervyatniks

9 posted on 07/16/2015 5:12:41 PM PDT by edpc (Wilby 2016)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Krosan

I heard that the Waco PD did it


21 posted on 07/16/2015 6:00:42 PM PDT by Noamie
[ Post Reply | Private Reply | To 1 | View Replies ]

To: A.A. Cunningham; AlexW; andyk; BatGuano; bayliving; Belteshazzar; bert; Bigg Red; bigheadfred; ...

Video, more photos, transcript at source: Never-before-seen footage reveals Russian-backed rebels arriving at the wreckage of MH17

May justice be done.

If you want to be on this right wing, monarchy, paleolibertarianism and nationalism ping list, but are not, please let me know. If you are on it and want to be off, also let me know. This ping list is not used for Catholic-Protestant debates.

27 posted on 07/16/2015 7:33:21 PM PDT by annalex (fear them not)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Krosan

Same ole Soviet Union. Shooting down unarmed civilian airlines. Remember the jet over the Pacific. Was it flight 007 or something like that. Korean or Japanese. Cannot remember at such an early hour.


35 posted on 07/17/2015 12:30:06 AM PDT by RetiredArmy (It is about THE CROSS. It has always been and always will be about the CROSS!!!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Krosan

In the video, the Ukrainian rebels at the site refer to paratroopers jumping from the plane. I’ve not heard this in any accounts in the news media.


38 posted on 07/17/2015 2:09:00 AM PDT by oblomov
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Krosan

Advice for Igor Strelkov
plastered on Novorossiya HQ in Donetsk

40 posted on 07/17/2015 2:22:14 AM PDT by cynwoody
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Krosan

Sad. The rebels are Ukrainian who consider themselves Russian. Their enemy are Ukranian who do not.
Malaysia air decides to fly over a war zone.....and of course this airline has a poor track record of late.

All very sad for the occupants and family of those occupants of the plane


46 posted on 07/17/2015 3:11:38 AM PDT by Vaquero ( Don't pick a fight with an old guy. If he is too old to fight, he'll just kill you.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Krosan

50 posted on 07/17/2015 3:30:47 AM PDT by Gay State Conservative (Obamanomics:Trickle Up Poverty)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Krosan

https://www.youtube.com/watch?v=kw9k_BwgGg0


82 posted on 07/17/2015 6:12:40 AM PDT by Slambat
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Krosan

I watched the 4:12 video on you tube. Not much new. The transcript contained more dialog then was in the video.


88 posted on 07/17/2015 4:39:09 PM PDT by BBell
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Krosan

Freaking animals


90 posted on 07/17/2015 5:19:41 PM PDT by rightistight
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Krosan

How We Know Russia Shot Down MH17

One year after 298 civilians fell to earth over eastern Ukraine, Putin’s regime is still denying culpability. Here’s definitive evidence to the contrary.

WRITTEN BY James Miller and Michael Weiss

http://www.thedailybeast.com/articles/2015/07/17/how-we-know-russia-shot-down-mh17.html


102 posted on 07/19/2015 12:06:37 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson