Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Greece Caves, Formally Requests ESM Bailout: Full Headline And Next Steps Summary
ZeroHedge ^ | 07/08/2015 | Tyler Durden

Posted on 07/08/2015 5:24:31 AM PDT by Wiz-Nerd

As we reported yesterday, following the latest European leaders summit, Greece was given until the end of the week to come up with a proposal for sweeping reforms in return for loans that will keep the country from crashing out of Europe's currency bloc and into economic ruin.

"The stark reality is that we have only five days left ... Until now I have avoided talking about deadlines, but tonight I have to say loud and clear that the final deadline ends this week," European Council President Donald Tusk told a news conference.

It did that moments ago when Greece officially submitted a request for a three-year loan facility from the European Stability Mechanism also promising to implement tax reform, and pension measures at the beginning of next week, which had been the biggest sticking point in negotiations for the past 5 months. And to think Syriza's main election promise was no more bailouts and the Greek people resoundly said not to just this over the weekend.

As Bloomberg reports, the loan will be used to meet Greece’s debt obligations, and to ensure financial system stability. Greece proposed immediate implementation of measures, including tax, pension reforms as early as next week. Govt to detail its proposals for specific reform agenda on July 9 at latest or tomorrow.


TOPICS: Business/Economy; Foreign Affairs; Germany; Government; United Kingdom
KEYWORDS: alexistsipras; austerity; eu; europeanunion; france; germany; greece; greecebailout; nato; syriza; tylerdurden; tylerdurdenmyass; unitedkingdom; zerohedge
Navigation: use the links below to view more comments.
first previous 1-2021-4041-45 next last
To: pepsionice
I get your point. But I'm guessing that many Greeks never thought of the EU money as needing to be repaid, just as the debt in Stockton, CA never seems to be repaid.

My point is that once it IS on you---that it IS your cash, your insulin---you tend to get serious. I'm not saying it won't be very painful. But as long as it was the EU's house "burning down," no one was going to care.

21 posted on 07/08/2015 6:40:17 AM PDT by LS ("Castles Made of Sand, Fall in the Sea . . . Eventually" (Hendrix))
[ Post Reply | Private Reply | To 18 | View Replies]

To: Red Badger

Agreed. But isn’t this the “Iceland” solution that has, so far, worked pretty well there?


22 posted on 07/08/2015 6:40:52 AM PDT by LS ("Castles Made of Sand, Fall in the Sea . . . Eventually" (Hendrix))
[ Post Reply | Private Reply | To 16 | View Replies]

To: LS

Icelanders are not Greeks. They are Scandinavian stock and will pick up the pieces and work hard to achieve a goal. The Mediterranean Greeks are like Californians. They want their freebies and will throw a fit if they don’t get them...................


23 posted on 07/08/2015 6:46:47 AM PDT by Red Badger (Man builds a ship in a bottle. God builds a universe in the palm of His hand.............)
[ Post Reply | Private Reply | To 22 | View Replies]

To: grania

I wonder how the Greek population is going to feel about their leaders fleeing the country with their fortunes when the SHTF?


24 posted on 07/08/2015 6:56:18 AM PDT by rfreedom4u (Chris Stevens won't be running for president.)
[ Post Reply | Private Reply | To 6 | View Replies]

To: Wiz-Nerd

This is like when your deadbeat, crack-addicted brother comes to you after refusing treatment a hundred times, VOCIFEROUSLY, and says, “Ok. I give up. Just give me 1000 more dollars, and I will enter treatment next week.”


25 posted on 07/08/2015 6:58:38 AM PDT by Lazamataz (I am so screwed.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: pepsionice; Texas Eagle
pepsi: Excellent report. Thanks.

A banker of my acquaintance pointed out that the entire economy of Greece is about the same size as the economy of Louisiana.

Texas: I love that! I think you're right.

26 posted on 07/08/2015 8:21:27 AM PDT by Steely Tom (Vote GOP: A Slower Handbasket)
[ Post Reply | Private Reply | To 8 | View Replies]

To: Wiz-Nerd

The proposal reportedly contains some degree of debt forgiveness. So it’s still a win for them.


27 posted on 07/08/2015 8:33:38 AM PDT by Buckeye McFrog
[ Post Reply | Private Reply | To 1 | View Replies]

To: Wiz-Nerd

So Tsipras backs down even after winning the referendum, guess he was never serious about anything. More extend and pretend. I wonder how the people and his own party are going to react to this?


28 posted on 07/08/2015 10:27:48 AM PDT by jimwatx
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith; AnonymousConservative; Berosus; bigheadfred; Bockscar; cardinal4; ColdOne; ...
Greece officially submitted a request for a three-year loan facility from the European Stability Mechanism also promising to implement tax reform, and pension measures at the beginning of next week, which had been the biggest sticking point in negotiations for the past 5 months. And to think Syriza's main election promise was no more bailouts and the Greek people resoundly said not to just this over the weekend.
FINOs and astroturf hardest hit!
29 posted on 07/08/2015 10:42:48 AM PDT by SunkenCiv (What do we want? REGIME CHANGE! When do we want it? NOW)
[ Post Reply | Private Reply | View Replies]

To: SunkenCiv; nuconvert; gandalftb
Beware of Greeks bearing bonds.

Is Putin Playing Puppetmaster in Greece?

http://www.thedailybeast.com/articles/2015/07/08/is-putin-playing-puppetmaster-in-greece.html

30 posted on 07/08/2015 2:04:12 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 29 | View Replies]

To: AdmSmith

Beware of Russians bearing gifts


31 posted on 07/08/2015 2:44:36 PM PDT by nuconvert ( Khomeini promised change too // Hail, Chairman O)
[ Post Reply | Private Reply | To 30 | View Replies]

To: jimwatx

Several years ago when the elected Greece government was removed and replaced with technocrats I thought the people would burn the place down.

Now I wonder if they are so beaten down they prefer serfdom over freedom.


32 posted on 07/09/2015 5:25:43 AM PDT by Wiz-Nerd
[ Post Reply | Private Reply | To 28 | View Replies]

To: AdmSmith

Thanks for this find!

To me it seems John R. Schindler is the guy who gives best analyses on what is going on in that part of the world from intelligence officers perspective. Too bad he will never be a famous pundit as he will always insist saying that Snowden is a traitor (and I agree), but that is not something main stream media allows.


33 posted on 07/09/2015 6:02:11 AM PDT by Krosan
[ Post Reply | Private Reply | To 30 | View Replies]

To: Krosan

Yes, and you may read these as well:

https://twitter.com/RadioFreeTom

https://twitter.com/edwardlucas

https://twitter.com/michaeldweiss

https://twitter.com/RobPulseNews

https://twitter.com/noclador


34 posted on 07/09/2015 1:40:34 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 33 | View Replies]

To: AdmSmith

Thanks! I was already reading Edward Lucas. His book “Deception: Spies, Lies and How Russia Dupes the West” was excellent.


35 posted on 07/09/2015 10:59:19 PM PDT by Krosan
[ Post Reply | Private Reply | To 34 | View Replies]

To: Wiz-Nerd

So what the hell was the point of that vote last week?


36 posted on 07/09/2015 11:10:24 PM PDT by stuck_in_new_orleans
[ Post Reply | Private Reply | To 1 | View Replies]

To: stuck_in_new_orleans
That was Greeks own vote. Of course Greeks won't decide if Europe gives them money or not. The deeper point behind it was that communists in charge want to follow the sequence

1. Set everything on fire
2. Now comes communism

They knew that regular Greeks don't want to set their country on fire so they arranged this situation, where it would happen, but instead of the communists in charge it would be blamed on Europe.

We'll see next week when rest of the Europe decides what will actually happen.

I am not using the word "communist" as an exaggeration. This is the actual picture of their prime minister.


37 posted on 07/10/2015 12:08:09 AM PDT by Krosan
[ Post Reply | Private Reply | To 36 | View Replies]

To: Krosan

Red background. He’s obviously a commie!!!!

Eyeroll


38 posted on 07/10/2015 5:22:28 AM PDT by stuck_in_new_orleans
[ Post Reply | Private Reply | To 37 | View Replies]

To: Wiz-Nerd

Stop it. I’m not going to say it again.

Stop it. I’m not going to say it again.

Stop it. I’m not going to say it again.

etc., etc., etc.


39 posted on 07/10/2015 5:36:50 AM PDT by Rocky (The further a society drifts from the truth, the more it will hate those who speak it. George Orwell)
[ Post Reply | Private Reply | To 1 | View Replies]

To: stuck_in_new_orleans

Picture was just illustrative.

https://en.wikipedia.org/wiki/Alexis_Tsipras

“Tsipras joined the Communist Youth of Greece in the late 1980s. In the early 1990s, as a student at Ampelokipoi Multi-disciplinary High School”

“As a university student, Tsipras joined the ranks of the renascent left-wing movement, particularly the “Enceladus” group”

“After the departure of the Communist Party of Greece from Synaspismos in 1991, Tsipras remained in the coalition. In May 1999 he became the first political secretary of Synaspismos’ youth-wing, the Synaspismos Youth. During this period he was described as a centrist, other than the very clear radical, left-wing profile he would later maintain as leader of Synaspismos.”


40 posted on 07/10/2015 9:01:05 AM PDT by Krosan
[ Post Reply | Private Reply | To 38 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-45 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson