Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Saddam Hussein aide, insurgent leader Izzat Ibrahim al-Douri reported killed in Iraq: Iraqi governor
Yahoo News ^ | 04/17/2015

Posted on 04/17/2015 8:02:27 AM PDT by SeekAndFind

BAGHDAD (Reuters) - A former aide to late Iraqi President Saddam Hussein and a leader of Iraq's insurgency, Ezzat Ibrahim al-Douri, may have been killed by Iraqi forces and Shi'ite militias involved in an operation against insurgent forces.

Raed al-Jubouri, the governor of Salahuddin province, told al-Arabiya television that al-Douri had been killed, and the station broadcast a photo of a dead man who looked like al-Douri.

"This is a major victory for those involved in the operation," al-Jubouri said. "He is considered a mastermind for this terrorist group," he said, referring to Islamic State, an offshoot of al Qaeda which has taken swathes of Syria and Iraq.

"For sure this will have an impact on them ... There will be a break among them," he said.

Baghdad has mounted an offensive against Islamic State and former Baathists once loyal to Saddam Hussein to retake territory in Iraq's Sunni heartland captured by jihadists last summer. Al-Douri was believed to be a key figure in that insurgency.

While Baghdad has announced al-Douri's death several times before, this time photos were circulating showing a man with similar features and red hair like al-Douri's. DNA from the body will be tested to confirm it is him, al-Jubouri.

(Excerpt) Read more at news.yahoo.com ...


TOPICS: Foreign Affairs; News/Current Events; War on Terror
KEYWORDS: aldhouri; aldouri; alduri; ezzat; ezzatibrahimaldouri; ginger; iraq; isis; islamicstate; izzat; izzatibrahimaldhouri; kingofclubs; saddamhussein
Navigation: use the links below to view more comments.
first 1-2021-34 next last

1 posted on 04/17/2015 8:02:27 AM PDT by SeekAndFind
[ Post Reply | Private Reply | View Replies]

To: SeekAndFind

His dead body photo is all over the twitter feed I go to each morning.


2 posted on 04/17/2015 8:05:01 AM PDT by ColdOne (I miss my poochie... Tasha 2000~3/14/11)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SeekAndFind

So it sounds like he was neutralized by the Shiites. Am I happy or blue?


3 posted on 04/17/2015 8:05:47 AM PDT by Genoa (Starve the beast.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SeekAndFind

Izzy’s been declared dead several times before.


4 posted on 04/17/2015 8:05:55 AM PDT by AU72
[ Post Reply | Private Reply | To 1 | View Replies]

To: Genoa

RE: So it sounds like he was neutralized by the Shiites. Am I happy or blue?

How do you prefer to die? To have your head chopped off or to be burned?


5 posted on 04/17/2015 8:07:56 AM PDT by SeekAndFind
[ Post Reply | Private Reply | To 3 | View Replies]

To: SeekAndFind

I’ve wondered over the years whatever happened to old Red. He was one of our top targets for awhile in 2003/04.


6 posted on 04/17/2015 8:07:59 AM PDT by ScottinVA (Hillary is nothing more than a white, wrinkled form of Obama in pants.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SeekAndFind

Number two in the playing card deck.


7 posted on 04/17/2015 8:08:33 AM PDT by SpaceBar
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith; Valin; piasa; Dog

pong


8 posted on 04/17/2015 8:09:40 AM PDT by nuconvert ( Khomeini promised change too // Hail, Chairman O)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SeekAndFind

Ibrahim, Izzat you?.....................

No answer.................


9 posted on 04/17/2015 8:12:02 AM PDT by Red Badger (Man builds a ship in a bottle. God builds a universe in the palm of His hand.............)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SeekAndFind

They’re playing it up like he was a mastermind of ISIS. I’m finding that a little hard to swallow, actually. Perhaps I underestimated the man.


10 posted on 04/17/2015 8:12:23 AM PDT by Genoa (Starve the beast.)
[ Post Reply | Private Reply | To 5 | View Replies]

To: SeekAndFind

An Iraqi Ginger?


11 posted on 04/17/2015 8:12:50 AM PDT by dfwgator
[ Post Reply | Private Reply | To 1 | View Replies]

To: SeekAndFind

Let them kill each other off. So we don’t have to.


12 posted on 04/17/2015 8:13:05 AM PDT by McGruff (Maybe my comments are too nuanced for some.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AU72
Izzy’s been declared dead several times before.

No he hasn't. Not sure where you get your 'facts'.
13 posted on 04/17/2015 8:13:15 AM PDT by SpaceBar
[ Post Reply | Private Reply | To 4 | View Replies]

To: SpaceBar
Number two in the playing card deck.

Yep. Amazing powers of survival, considering.

14 posted on 04/17/2015 8:14:45 AM PDT by Billthedrill
[ Post Reply | Private Reply | To 7 | View Replies]

To: All
“A group of security forces went and surrounded the area and those terrorists were killed. Three of them were suicide bombers and blew themselves up. Amongst the bodies was al-Douri’s,” he said.

Guess He Didn't Blow Up Real Good if they found a body.

15 posted on 04/17/2015 8:16:52 AM PDT by McGruff (Maybe my comments are too nuanced for some.)
[ Post Reply | Private Reply | To 10 | View Replies]

To: nuconvert


source: http://english.alarabiya.net/en/News/middle-east/2015/04/17/Key-Saddam-aide-and-ISIS-commander-Ezzat-al-Douri-killed.html
16 posted on 04/17/2015 8:20:15 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8 | View Replies]

To: nuconvert; Cap Huff

Thank you...the redhead.


17 posted on 04/17/2015 8:24:59 AM PDT by Dog (..."I'm just a cook...")
[ Post Reply | Private Reply | To 8 | View Replies]

To: SpaceBar
Izzy’s been declared dead several times before. No he hasn't. Not sure where you get your 'facts'.

Yes he has where do you get your 'facts?

BBC Nov 13, 2005 - One of Saddam Hussein's most trusted aides, Izzat Ibrahim al-Douri, died of cancer, Iraq's ex-ruling party says.

Death of Hussein Aide Is Confirmed - New York Times www.nytimes.com/2005/11/13/.../13iraq.html?...all The New York Times

Nov 13, 2005 - BAGHDAD, Iraq, Nov. 12 - Former officials of the Baath Party confirmed Saturday on their Web site the death of Izzat Ibrahim al-Douri, the last of ...

Saddam Deputy Possibly Captured or Killed (Izzat Ibrahim ...

The Assassin - Page 98 - Google Books Result https://books.google.com/books?isbn=0786022736 Andrew Britton - 2008 - ‎Fiction ... for he knew that this man, Izzat Ibrahim al-Douri, former vice president of Iraq, ... who was believed to be in his mid-sixties, had died of leukemia in November ...

18 posted on 04/17/2015 8:28:10 AM PDT by AU72
[ Post Reply | Private Reply | To 13 | View Replies]

To: AU72

And all of those stories subsequently went silent.

He’s never been declared dead by the US military.


19 posted on 04/17/2015 8:30:44 AM PDT by SpaceBar
[ Post Reply | Private Reply | To 18 | View Replies]

To: Dog
:
20 posted on 04/17/2015 8:37:22 AM PDT by nuconvert ( Khomeini promised change too // Hail, Chairman O)
[ Post Reply | Private Reply | To 17 | View Replies]


Navigation: use the links below to view more comments.
first 1-2021-34 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson