Free Republic
Browse · Search
News/Activism
Topics · Post Article

Ian Morris, a professor of classics at Stanford University, is the author of “War! What is it Good For? Conflict and the Progress of Civilization from Primates to Robots.”
1 posted on 04/26/2014 9:34:04 PM PDT by Brad from Tennessee
[ Post Reply | Private Reply | View Replies ]


To: Brad from Tennessee

WWI was a good thing. What a fool.


2 posted on 04/26/2014 9:36:39 PM PDT by DManA
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Brad from Tennessee

humm: progress through war (or let’s just say human conflict of varied types).

that strikes me as another very good encapsulation of leftist (progressive) ideology and practice.


3 posted on 04/26/2014 9:46:12 PM PDT by dadfly
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Brad from Tennessee
A delightfully contrarian point of view, although I'm not sure it's intended to be taken entirely seriously. One can always find a point of view whereby war is an advantage, but it's usually by shifting one's perspective to that of the winner.

What we have here is a perspective that shifts from the broad view to the narrow one when it suits the argument. Government is not always preferable to chaos, especially when it's trying to put your carcass into an oven for the Greater Good. Whether that beats a no-government situation in which a marauding barbarian puts a spear into your guts is one of those fine points I won't explore overmuch. Either way, you lose.

What does work is the empowerment of the individual to guard himself and his against both scenarios. If, to do so, he must make war, then once again we have shifted our perspective to the advantage of the fight. I'd offer a slight corrective: apparently we can't avoid it, so we might as well be good at it. That doesn't necessarily extend to celebrating it.

5 posted on 04/26/2014 9:49:34 PM PDT by Billthedrill
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Brad from Tennessee

I’d like to be safer.

Can we nuke Mecca, Cairo, Jakarta, Karachi and Ankara please?


6 posted on 04/26/2014 9:50:31 PM PDT by BenLurkin (This is not a statement of fact. It is either opinion or satire; or both.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Brad from Tennessee
So yes, war is hell — but have you considered the alternatives?

Yes. War created the United States - an absolute positive for the world in the last 200 years. War ended slavery in the US. War ended the subjugation of Europe and the extermination of the Jews and Gypsies by the Nazis. War has ended genocide in Bangladesh and in the former Yugoslavia since then. War is sometimes necessary for the long-term good of the human race - and those who willfully blind themselves to that fact don't do the human race any favors.
7 posted on 04/26/2014 9:50:51 PM PDT by AnotherUnixGeek
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Brad from Tennessee

Wow, this is a thinly veiled attack on Ronald Reagan.


8 posted on 04/26/2014 9:51:17 PM PDT by nickcarraway
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Brad from Tennessee; Cicero
When looking upon the long run of history, it becomes clear that through 10,000 years of conflict, humanity has created larger, more organized societies that have greatly reduced the risk that their members will die violently.

This is the logical fallacy, post hoc, ergo propter hoc. The author fails to adduce evidence that the larger, more organized societies would not have been created without the violent conflicts he deems to have been necessary.

11 posted on 04/26/2014 9:53:22 PM PDT by aposiopetic
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Brad from Tennessee

In the 20th century some 200+ million people were killed by their own governments, not in wars, so I’m not sure about the claim that modern people are safer.


19 posted on 04/26/2014 10:27:33 PM PDT by TigersEye (Stupid is a Progressive disease.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Brad from Tennessee

He’s a bean counter and it’s true that certain types of wars have a bottom line to them. People like him can reason the human suffering away, while those suffering can’t.


20 posted on 04/26/2014 10:46:46 PM PDT by Usagi_yo
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Brad from Tennessee

“War! What is it Good For?”

http://www.youtube.com/watch?v=01-2pNCZiNk


24 posted on 04/27/2014 3:14:22 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Brad from Tennessee

War is indeed the mother of civilization. Small hunter-gatherer bands were constantly in conflict. Early agricultural settlements were constantly feuding with the tribe over the hill, across the river, or in the next glen. The death toll from constant raids and skirmishes was extremely high. Leadership in such societies was usually a duopoly between the elders, thought to be wise, and the battle leaders. People eventually formed larger state to improve their chances of winning wars. States grew because they won wars.


25 posted on 04/27/2014 3:23:33 AM PDT by sphinx
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Brad from Tennessee

it becomes clear that through 10,000 years of conflict, humanity has created larger, more organized societies that have greatly reduced the risk that their members will die violently. “

Yep when the Communists rolled into Russia, Cuba, China, when the NAZI’s stood astride Germany and then a good deal of Europe EVERYONE breathed a sigh of relief and said “Cool, now we can live!”


28 posted on 04/27/2014 4:23:10 AM PDT by TalBlack (Evil doesn't have a day job.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Brad from Tennessee

war is a Darwinian mechanism that sorts out the weak and the strong.

The Germans bent on gaining territory and thus population were at bottom line intent on expanding their gene pool. ditto the Japanese.

Hitler erred...... he took on Russia and the result was a genetic dilution from death and raped women. His gambit failed miserably. The aggressive German population was and is subdued by genes. The long occupation altered the population genetic make up.

an interesting factor was the introduction of America into the mix. The American culture prevailed even though there was not much rape, there was gene swapping as a result of the influx.

Putin needs population and Russian genes to shore up his failing gene pool. Mother Russia is severely ailing


29 posted on 04/27/2014 4:35:34 AM PDT by bert ((K.E. N.P. N.C. +12 ..... History is a process, not an event)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Brad from Tennessee
What a pantload! Wars have not made us safer and richer. Defeating tyrannical governments in wars have made us safer and richer. You do not need to read far between the lines and Ian Morris admits as much.
31 posted on 04/27/2014 4:38:49 AM PDT by Vigilanteman (Obama: Fake black man. Fake Messiah. Fake American. How many fakes can you fit in one Zer0?)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Brad from Tennessee

Tell it to the Carthaginians, or a dozen other peoples annihilated by neighboring empires. The winners right the history books, and conclude that “It was worth it.” Anyone who thinks the Great War was worth it is an idiot.


32 posted on 04/27/2014 4:39:07 AM PDT by Lonesome in Massachussets (This is known as "bad luck". - Robert A. Heinlein)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Brad from Tennessee

All he is saaaying, is give war a chance.


38 posted on 04/27/2014 7:50:52 AM PDT by luvbach1 (We are finished. It will just take a while before everyone realizes it.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Brad from Tennessee

We get richer indirectly about 20 years later as a result of the massive investment in “cutting edge” technologies done under threat of death. A cold war is by far the best war of all. This communication is brought to you indirectly by the Cold War invention of the Advanced Research Projects Agency Network (ARPANET). The internet boom started about 20 years after its implementation. Currently DARPA is investing heavily in robotics. 20 years from now you will own several general purpose robots... and probably have no job.


41 posted on 04/27/2014 9:17:56 AM PDT by Reeses
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Brad from Tennessee
Extremely small government meant there was at least some law and order; no government meant that there was not.

While government in moderation is a very good thing, more is not better. The benefit curve forms an arc. We are clearly on the downward slope right now. The source of much conflict is that people living in high density communes called cities need more government while people living in America need less. Leftists believe one size fits all for government intrusion and centralized planning, but that is clearly not the case.

44 posted on 04/27/2014 9:35:28 AM PDT by Reeses
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Brad from Tennessee

If we’d have demanded war reparations from Iraq our national debt would not be $17 Trillion and gas would not be $3.50 a gallon.


79 posted on 04/28/2014 3:13:41 PM PDT by The Sons of Liberty ("Our brethren are already in the field! Why stand we here idle?" - Patrick Henry, 1775)
[ Post Reply | Private Reply | To 1 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson