Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

High radiation readings found at Fukushima tanks (NEW LEAK)
Japan Today ^ | 09/01/13 | staff

Posted on 09/01/2013 7:10:12 AM PDT by winoneforthegipper

At the time of last week’s discovered leak the plant operator said the radioactivity of the puddles was around 100 millisieverts per hour.

Jiji news agency said the highest reading of 1,800 millisieverts per hour was found at one of the tanks, adding that exposure to that level for four hours would be fatal to humans. The other readings measured between 70 and 230 millisieverts, the agency added.

A TEPCO official said the operator could not rule out the possibility of new leaks of radioactive water at the four sites, the agency reported, adding that the operator had not noticed a decline in water levels inside the tanks.

(Excerpt) Read more at japantoday.com ...


TOPICS: Japan; News/Current Events
KEYWORDS: fukushima; nuclear; nuclearpower; radiation
Navigation: use the links below to view more comments.
first previous 1-20 ... 221-240241-260261-280 ... 301-306 next last
To: winoneforthegipper

He shoots, he scores :)


241 posted on 09/05/2013 3:39:35 PM PDT by The Cajun (Sarah Palin, Mark Levin, Ted Cruz......Nuff said.)
[ Post Reply | Private Reply | To 239 | View Replies]

To: machogirl

Well thanks! In honesty though more like just noticed the pattern than I predicted....lol

What I will say though is this; I am not sure how long the sequence was there before I noticed or how long it will last but it is my impression that the pattern will terminate only after a large quake at one of the three areas involved.

My bet is the east coast and I am thinking more precisely off shore delmarva for a few reasons that I will share later maybe if I find some quality time to try and express it...lol


242 posted on 09/05/2013 3:42:04 PM PDT by winoneforthegipper ("If you can't ride two horses at once, you probably shouldn't be in the circus" - SP)
[ Post Reply | Private Reply | To 240 | View Replies]

To: winoneforthegipper

Okay, you’ve got my attention! ;)


243 posted on 09/05/2013 3:48:50 PM PDT by Errant
[ Post Reply | Private Reply | To 235 | View Replies]

To: Errant; The Cajun

Thanks guys!


244 posted on 09/05/2013 3:51:03 PM PDT by winoneforthegipper ("If you can't ride two horses at once, you probably shouldn't be in the circus" - SP)
[ Post Reply | Private Reply | To 243 | View Replies]

To: winoneforthegipper; Errant; machogirl
My bet is the east coast and I am thinking more precisely off shore delmarva for a few reasons that I will share later maybe if I find some quality time to try and express it...lol

Think we are going to keep a real close eye on you if it goes down like that, LOL!

245 posted on 09/05/2013 4:13:13 PM PDT by The Cajun (Sarah Palin, Mark Levin, Ted Cruz......Nuff said.)
[ Post Reply | Private Reply | To 242 | View Replies]

To: The Cajun; Errant; machogirl

Oh boy...that’s not good....lol

I also dabble in weather forecasting and excel at that. Specific to eastern Pa area but for tropics I tackle any Atlantic Entity...

If you three ever want t to follow along...

https://www.facebook.com/pages/WeatherWise/116223931795050


246 posted on 09/05/2013 4:21:25 PM PDT by winoneforthegipper ("If you can't ride two horses at once, you probably shouldn't be in the circus" - SP)
[ Post Reply | Private Reply | To 245 | View Replies]

To: winoneforthegipper

Thanks, I’ll take you up on that.


247 posted on 09/05/2013 4:30:21 PM PDT by machogirl (First they came for my tagline)
[ Post Reply | Private Reply | To 246 | View Replies]

To: winoneforthegipper
Kind of a weather nerd myself, have two remote weather stations in the backyard.

Belong to two hurricane weather sites.
Lots of fun trying to predict weather right next to the Gulf of Mexico.
Kind of a crap shoot during the summer when thunderstorms bubble up real quick, sometimes right on top of you.

248 posted on 09/05/2013 4:31:55 PM PDT by The Cajun (Sarah Palin, Mark Levin, Ted Cruz......Nuff said.)
[ Post Reply | Private Reply | To 246 | View Replies]

To: The Cajun; machogirl

MG- Awesome I would find that and honor

Cajun- well awesome then we might have some great conversations in the next weeks.

Here was my 2013 tropic prediction....

WeatherWise
May 30
Well seeing the activity in the tropics has heated up and also confirms my thinking....Lets talk tempests....!

While most forecast centers are thinking this year’s Atlantic Hurricane season will be one to remember, I have to dampen those thoughts a bit.

While it is true that the Atlantic Ocean is looking remarkable and the Cape Verde waters are well above average in temp, the devil in the details is that the Pacific Hurricane season could be epic.

When the Pacific is busy, the balance is that the GOM and Caribbean are to muddled by that activity to be productive. The Pacific has already spawned two storm one of which has now crossed over mexico and is currently re-energizing in the bay of Campeche. Posing the first threat to the USA if it does.

That said....we here on the East Coast do have to consider that the long tracked Cape Verde/Eastern Atantic Storms might actually have a better than average chance of taking the turn towards the east coast because of the Pacific Tropics.

So my thinking is that the numbers that some are using are just to inflated given the nature of the season....but that does not mean we will be in any better shape....lol


249 posted on 09/05/2013 4:49:57 PM PDT by winoneforthegipper ("If you can't ride two horses at once, you probably shouldn't be in the circus" - SP)
[ Post Reply | Private Reply | To 248 | View Replies]

To: winoneforthegipper

Thank you very much for the offer, but I don’t have a facebook account - that’s just my eccentric nature. :)


250 posted on 09/05/2013 5:00:00 PM PDT by Errant
[ Post Reply | Private Reply | To 246 | View Replies]

To: Errant

You don’t need a facebook account for that page...just read...lol


251 posted on 09/05/2013 5:04:06 PM PDT by winoneforthegipper ("If you can't ride two horses at once, you probably shouldn't be in the circus" - SP)
[ Post Reply | Private Reply | To 250 | View Replies]

To: winoneforthegipper
Been a weird and calm year so far in the Gulf, hope it stays that way.

Probably 2-3 weeks away from getting decent fronts coming down into the Gulf, should start to cool it down some.

It's been an unusually coolish summer, only got into the 97-99 deg temps a couple of days, never broke 100 yet.

On a side note, this has been the craziest year for grass with all the rain and humidity.
The neighbors and myself just can't keep up, even the sugarcane crop is growing like crazy.
A couple of buddies were saying that we could cut the grass twice a week right now, weird this year, growing season on steroids for some reason.

252 posted on 09/05/2013 5:11:59 PM PDT by The Cajun (Sarah Palin, Mark Levin, Ted Cruz......Nuff said.)
[ Post Reply | Private Reply | To 249 | View Replies]

To: winoneforthegipper

Well, in that case, I surely will... :)


253 posted on 09/05/2013 6:43:29 PM PDT by Errant
[ Post Reply | Private Reply | To 251 | View Replies]

To: winoneforthegipper; nuconvert; Errant; SunkenCiv; gandalftb
How come that journalist have problems in writing about nuclear physics? Do they want to lie and scare people?

I add some lines from Atomic insights:

The latest media discovery was that the reading that was initially reported as 100 mSv/hour was really 1,800 mSv/hour because the detector that produced the 100 mSv/hour reading had a range that maxed out at 100 mSv/hour. What few, if any, media reports include is an explanation that the measured dose rate is nearly 100% beta radiation and that it was measured at a distance of just 70 micrometers from the radioactive material. Beta radiation can be shielded by a single sheet of paper and will only travel about 1-2 meters in dry air.

Someone needs to help journalists understand that there is no way that a beta-emitting radiation source can cause a deadly dose to a human being unless it is ingested in a concentrated form. Even if it is in direct contact, about the worst it can do is cause a skin burn; I would also not recommend using water contaminated with a beta emitter for eye wash. I suppose I have volunteered for that educational task.
As some of the more informative initial reports stated, the gamma radiation from the leaked water measured 1.5 mSv/hour. That number is still valid; it was well within the accurate measuring range of the instrument used.

http://atomicinsights.com/another-update-highly-radioactive-water-leaks-fukushima/

read as well
http://japandailypress.com/nra-chief-says-situation-at-fukushima-exaggerated-0535399/

254 posted on 09/06/2013 1:23:10 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: winoneforthegipper

The China syndrome only exists in the imagination, it is not real.


255 posted on 09/06/2013 1:28:04 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 77 | View Replies]

To: winoneforthegipper
Today’s readings were as high as 1700 milisieverts.

Yes, but it is beta radiation and at a very short distance i.e. not dangerous, it can be stopped by a newspaper.
256 posted on 09/06/2013 1:31:21 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 85 | View Replies]

To: AdmSmith

Yep no one is debating that per say at this point. More the question is...why the spike.

Secondary is Tepco released the beta info a day after releasing the numbers so it’s a bit skeptical and typical of TEPCO to be somewhat less than real with their followup damage control...lol


257 posted on 09/06/2013 1:40:11 PM PDT by winoneforthegipper ("If you can't ride two horses at once, you probably shouldn't be in the circus" - SP)
[ Post Reply | Private Reply | To 256 | View Replies]

To: AdmSmith

As for the China Syndrome you are wrong on that. In fact it already happened in Fukushima.

Not the movie but the true description of the incident. You will find a link on this thread as to where the term was first used.


258 posted on 09/06/2013 1:42:12 PM PDT by winoneforthegipper ("If you can't ride two horses at once, you probably shouldn't be in the circus" - SP)
[ Post Reply | Private Reply | To 255 | View Replies]

To: winoneforthegipper

I guess you mean LOCA http://en.wikipedia.org/wiki/Loss-of-coolant_accident I anticipate that you know that there is absolutely zero probablitilty that a molten core would burn through Earth to the other side (China).


259 posted on 09/06/2013 1:56:25 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 258 | View Replies]

To: winoneforthegipper

I agree with you that TEPCO is incompetent.


260 posted on 09/06/2013 1:58:14 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 257 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 221-240241-260261-280 ... 301-306 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson