Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Chicago Pile 70 years tomorrow Dec 2.
Argonne National Lab ^ | 9 jul 2012 | Staff

Posted on 12/01/2012 10:18:37 AM PST by AdmSmith

On December 2, 1942, 49 scientists, led by Enrico Fermi, made history when Chicago Pile 1 (CP-1) went critical and produced the world's first self-sustaining, controlled nuclear chain reaction.


TOPICS: Business/Economy; Extended News
KEYWORDS: alteredsource; alteredtitle; hdptfe; nuclear; power; stringtheory; vanity
Navigation: use the links below to view more comments.
first 1-2021-34 next last
We should celebrate the great achievement done 70 years ago. Unfortunately, nothing in MSM.
1 posted on 12/01/2012 10:18:47 AM PST by AdmSmith
[ Post Reply | Private Reply | View Replies]

To: gandalftb; TigerLikesRooster; SunkenCiv

Short video http://www.youtube.com/watch?v=0tKf7R2XncM

long http://www.youtube.com/watch?v=vv_0STVP044

http://en.wikipedia.org/wiki/Chicago_Pile-1


2 posted on 12/01/2012 10:20:52 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

They were excited when it worked and even more excited when their theories on how to stop it worked.


3 posted on 12/01/2012 10:21:03 AM PST by gorush (History repeats itself because human nature is static)
[ Post Reply | Private Reply | To 1 | View Replies]

To: gorush

having served on board a nuclear sub. I have nothing but awe and respect for what they accomplished.


4 posted on 12/01/2012 10:25:53 AM PST by brivette
[ Post Reply | Private Reply | To 3 | View Replies]

To: AdmSmith

Deep down in your hearts, you Right Wing Nuts really know that the author of this article is not talking about either one of us when he uses the term Chicago pile!

5 posted on 12/01/2012 10:30:15 AM PST by Zakeet (Calling the Obozo/Bernack economy sluggish is an insult to slugs)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

Remarkable! I never knew the story.

I just finished “Madame Curie”... unbelievable woman, discoveries, contributions.

Thanks for the post.


6 posted on 12/01/2012 10:38:37 AM PST by freeagle
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

If the MSM mentioned it at all, it would be to say what a terrible thing it was.

My dad was a grad student there at the time, though he wasn’t directly involved with building the pile. He was working on the problem of how to separate U-235 from U-238.


7 posted on 12/01/2012 10:38:47 AM PST by Fresh Wind (Cut the cable today!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Zakeet

That would be the Chicago (dog) pile.

8 posted on 12/01/2012 10:43:24 AM PST by uglybiker (nuh-nuh-nuh-nuh-nuh-nuh-nuh-nuh-nuh-nuh-nuh-nuh-nuh-nuh-nuh-nuh-BATMAN!)
[ Post Reply | Private Reply | To 5 | View Replies]

To: AdmSmith

And two and a half years later, BIG BOOM and FLASH over Hiroshima & Nagasaki. War over!!


9 posted on 12/01/2012 10:48:58 AM PST by Elsiejay
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

What was the number of the Chicago Pile that turned into Barry Soetoro?


10 posted on 12/01/2012 10:49:12 AM PST by Arthur McGowan (If you're FOR sticking scissors in a baby girl's neck and sucking out her brains, you are PRO-WOMAN!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith
We should celebrate the great achievement done 70 years ago Unfortunately, nothing in MSM

ObamaMSM says no reason to celebrate because you didn't build it.

11 posted on 12/01/2012 10:50:44 AM PST by presently no screen name
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith
Day One

Outstanding film about the making of the atomic bomb which restages the dramatic "Pile" sequence.

12 posted on 12/01/2012 11:06:02 AM PST by onedoug
[ Post Reply | Private Reply | To 1 | View Replies]

To: All

It’s amazing that some of these people are still alive and can share history with us.


13 posted on 12/01/2012 11:17:59 AM PST by Nowhere Man (It is about time we re-enact Normandy, at the shores of the Potomac.)
[ Post Reply | Private Reply | To 12 | View Replies]

To: Elsiejay

I talked to a man who was in the Army on Tinian the day they loaded up the Enola Gay. He remembers watching it but it was covered up so he wasn’t sure what was going on. The plane took off and returned and he remembers serving Colonial Tibbetts in the officer;s club where Tibbetts kept going on “what we have done?” He passed away this year at the age of 90. It’s amazing to talk to someone who was there. BTW, he remembers Bocks Car too.


14 posted on 12/01/2012 11:22:07 AM PST by Nowhere Man (It is about time we re-enact Normandy, at the shores of the Potomac.)
[ Post Reply | Private Reply | To 9 | View Replies]

To: freeagle

Suggest you read next: “The Making of the Atomic Bomb” by Richard Rhodes and “American Prometheus” by Kai Bird and Martin J. Sherwin (bigraphy of Oppenheimer). They’ll be great follow-ons!


15 posted on 12/01/2012 11:58:03 AM PST by ProtectOurFreedom
[ Post Reply | Private Reply | To 6 | View Replies]

To: ProtectOurFreedom
“The Making of the Atomic Bomb” by Richard Rhodes

Truly one of the most outstanding works of non-fiction of the past 25 years. The first paragraph of the first chapter sets the tone of this compelling book:


16 posted on 12/01/2012 12:17:43 PM PST by billorites (freepo ergo sum)
[ Post Reply | Private Reply | To 15 | View Replies]

To: AdmSmith; 6SJ7; AFPhys; Arkinsaw; allmost; aristotleman; autumnraine; Beowulf; Bones75; BroJoeK; ...

Thanks AdmSmith!


· List topics · post a topic · subscribe · Google ·

17 posted on 12/01/2012 12:44:33 PM PST by SunkenCiv (https://secure.freerepublic.com/donate/)
[ Post Reply | Private Reply | View Replies]

To: Zakeet
fermi and others were worried a giant black hole might occur..

prophetic they were.. or ?

18 posted on 12/01/2012 12:56:22 PM PST by NormsRevenge (Semper Fi)
[ Post Reply | Private Reply | To 5 | View Replies]

To: AdmSmith
At the Trinity test, Fermi offered bets as to whether the bomb would ignite the atmosphere and if it would destroy the world or just New Mexico.

He was a real card. :)

19 posted on 12/01/2012 1:00:48 PM PST by TonyInOhio
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

Some years back I was on a project at the U of Chicago.

I recalled a sculpture that marks the spot and ask Dave (my boss) if we were near the original site.

Dave about choked! Then said, safety had reviewed the area? The tunnels are like a maze and people often get lost. The tunnels are semi public and should have been safe but if safety or OSHA were to visit I would have had some explaining to do.


20 posted on 12/01/2012 5:15:03 PM PST by DUMBGRUNT (The best is the enemy of the good!)
[ Post Reply | Private Reply | To 1 | View Replies]


Navigation: use the links below to view more comments.
first 1-2021-34 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson