Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

The Nobel Prize in Physiology or Medicine 2011 (2/3 to the US)
The Nobel prize Foundation ^ | Oct 3, 2011 | Staff

Posted on 10/03/2011 3:19:27 AM PDT by AdmSmith

The Nobel Assembly at Karolinska Institutet has today decided that

The Nobel Prize in Physiology or Medicine 2011

shall be divided, with one half jointly to

Bruce A. Beutler and Jules A. Hoffmann

for their discoveries concerning the activation of innate immunity

and the other half to

Ralph M. Steinman

for his discovery of the dendritic cell and its role in adaptive immunity

This year's Nobel Laureates have revolutionized our understanding of the immune system by discovering key principles for its activation.

Scientists have long been searching for the gatekeepers of the immune response by which man and other animals defend themselves against attack by bacteria and other microorganisms. Bruce Beutler and Jules Hoffmann discovered receptor proteins that can recognize such microorganisms and activate innate immunity, the first step in the body's immune response. Ralph Steinman discovered the dendritic cells of the immune system and their unique capacity to activate and regulate adaptive immunity, the later stage of the immune response during which microorganisms are cleared from the body.

The discoveries of the three Nobel Laureates have revealed how the innate and adaptive phases of the immune response are activated and thereby provided novel insights into disease mechanisms. Their work has opened up new avenues for the development of prevention and therapy against infections, cancer, and inflammatory diseases.

(Excerpt) Read more at nobelprize.org ...


TOPICS: Culture/Society; Extended News
KEYWORDS: immunology; nobel
http://www.nobelprize.org/nobel_prizes/medicine/laureates/2011/press.pdf
1 posted on 10/03/2011 3:19:33 AM PDT by AdmSmith
[ Post Reply | Private Reply | View Replies]

http://www.nobelprize.org/nobel_prizes/medicine/laureates/2011/press.pdf


2 posted on 10/03/2011 3:20:19 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv

This research is important for developing new vaccines and treatment for autoimmune diseases.


3 posted on 10/03/2011 3:23:35 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 2 | View Replies]

=> treatment of autoimmune and inflammatory diseases.
4 posted on 10/03/2011 3:25:41 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 3 | View Replies]

To: AdmSmith

Did they all reach a consensus though? That is an important thing in science, right?


5 posted on 10/03/2011 4:34:21 AM PDT by mc5cents
[ Post Reply | Private Reply | To 1 | View Replies]

To: mc5cents
The first two worked with innate immunology and it turned out that the insect Toll gene (Hoffmann) expressed a receptor that is very similar to the mammalian Toll Like Receptor (TLR) discovered later by Beutler.

The innate immunology is the first line of defense and is non-specific, fast and has no memory of earlier infections.

Steinman discovered, 25 years earlier, in 1973, the dendritic cell, a cell that controls adaptive immunity that is the second line of defense. It is slow and has memory, and is the cell type that is active when we get vaccines.

Consensus is related to the interpretation of the experiments and is not as important as being able to repeat the experiments. If a discovery is done that can be repeated, it might be the case that it is in conflict with the general consensus about what is happening. Then someone has to think and that is normally done by only on person and if he or she figures out an explanation it might later be part of the “consensus”.

6 posted on 10/03/2011 6:01:05 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5 | View Replies]

To: SunkenCiv
Unfortunately, Ralph Steinman died last Friday in pancreatic cancer. i.e he got the prize three days after his death.

http://www.theglobeandmail.com/news/national/canadian-nobel-prize-winner-died-of-pancreatic-cancer-university-says/article2188491/

According to the regulations you can not get the prize if you are dead. My guess is that it will be issued to him anyhow.

7 posted on 10/03/2011 6:16:24 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 6 | View Replies]

To: AdmSmith; neverdem; DvdMom; grey_whiskers; Ladysmith; Roos_Girl; Silentgypsy; conservative cat; ...

Ping

Thanks, AdmSmith.


8 posted on 10/03/2011 7:44:30 AM PDT by decimon
[ Post Reply | Private Reply | To 7 | View Replies]

To: AdmSmith

BTTT!


9 posted on 10/09/2011 6:24:33 PM PDT by neverdem (Xin loi minh oi)
[ Post Reply | Private Reply | To 1 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson