Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

In Saudi Arabia, reformers intensify calls for change
Christian Science Monitor ^ | 2-22-11 | Caryle Murphy

Posted on 02/22/2011 5:16:37 PM PST by Mozilla

Riyadh, Saudi Arabia

When his royal jet lands here in the Saudi capital on Wednesday, ending a three-month absence, King Abdullah bin Abdul Aziz will find a nation seemingly moored in the eye of the epic storm howling around it.

But it is also clear that the octogenarian king, who went to New York in late November for back surgery and then to Morocco to convalesce, is returning to a realm touched in significant ways by the youth rebellions roiling the Middle East.

More than ever before, Saudis are openly calling for change, including political reforms. The most vociferous are tech-savvy youths who have obsessively followed their peers’ historic movements, especially in Egypt, on Twitter and Facebook.

In a move timed to the king’s return Wednesday, a group of 40 young Saudis, mostly journalists and rights activists, have signed an open “Letter to the King.”

The signers say they were inspired by Arab youth elsewhere, and by the king’s encouragement of national dialogue. They asked for elections for the advisory Shura Council, the right of women to vote and run as candidates, strong anticorruption measures, and greater fiscal transparency and accountability.

In addition, they want the Cabinet reshuffled so that ministers’ average age, now 65, is reduced to 40.

In another effort – albeit one that did not get very far – 10 moderate Islamists, including university professors and lawyers, defied the ban on political parties and announced they were forming the Islamic Umma Party.

(Excerpt) Read more at csmonitor.com ...


TOPICS: News/Current Events
KEYWORDS: islam; revolts; saudiarabia; unrest
Saudi Arabia seems to be the next country which will start having protests.
1 posted on 02/22/2011 5:16:39 PM PST by Mozilla
[ Post Reply | Private Reply | View Replies]

To: Mozilla

You want to see the US and the rest of the world plunge into a deep Depression that will make the past three years seem like a picnic? Have these savages take over Saudi Arabia too. The sad part is Obama and his team have no idea how to stop it and even if they did, they don’t have the will to.


2 posted on 02/22/2011 5:20:22 PM PST by Opinionated Blowhard ("The time will come when Winter will ask you what you were doing all Summer" -- Henry Clay)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Mozilla
Saudi Arabia Uprising Could Mean $140-Plus Oil

WhistlingPastTheGraveyard put the link for the Facebook protest in this post

3 posted on 02/22/2011 5:20:55 PM PST by FromLori (FromLori">)
[ Post Reply | Private Reply | To 1 | View Replies]

To: FromLori

$140? Yeah right. More like $200.


4 posted on 02/22/2011 5:23:40 PM PST by MinorityRepublican
[ Post Reply | Private Reply | To 3 | View Replies]

To: Opinionated Blowhard
The sad part is Obama and his team have no idea how to stop it

Stop it? He's in favor of it!

He's the Rightly Guided One (or so he thinks).

5 posted on 02/22/2011 5:24:44 PM PST by SonOfDarkSkies ('And what rough beast, its hour come round at last, slouches towards Bethlehem to be born?' Yeats)
[ Post Reply | Private Reply | To 2 | View Replies]

Comment #6 Removed by Moderator

To: Opinionated Blowhard

Although I have no direct proof, I think Iran is intimately connected to all this.

If Saudi Arabaia and Bahrain fall, there goes most of our oil supply. They can sell it to China, so that won’t matter much to the idiots rampaging.

Iran is effectively taking down the United States, and Obama is still blissfully daydreaming about the wonders of bringing Sharia to the U. S.

Evidently he hopes for veils, cutting off schooling and work opportunities, as well as selection of their own husbands, an enjoyable love life, and freedom from being stoned if they are every accosted by a man. No Barack, there is no moral superiority about Western culture is there. /s

As for Michelle, she has been trying to monitor what everyone is eating, so I won’t give her grief.

Talk about your two clueless dregs...


7 posted on 02/22/2011 5:27:39 PM PST by DoughtyOne (Here's the proof of Obama's U. S. citizenship: " " Good enough for our 3 branches...)
[ Post Reply | Private Reply | To 2 | View Replies]

To: Mozilla
Yet Obama has simultaneously shut down domestic oil exploration and production. Almost like it's all been orchestrated.
8 posted on 02/22/2011 5:32:10 PM PST by circlecity
[ Post Reply | Private Reply | To 1 | View Replies]

To: DoughtyOne
Speaking of Bahrain...

And Back To Bahrain, Where Tens Of Thousands Join Fresh Anti-Government Protest

9 posted on 02/22/2011 5:47:50 PM PST by FromLori (FromLori">)
[ Post Reply | Private Reply | To 7 | View Replies]

To: FromLori

Thanks for the link. So they are preparing to revolt and have a date set.

Obama’s plan in apologizing in the middle east failed miserably. He should have been tougher in his stance with terrorism. Obama has done nothing to stop extremists from taking power. As such they have a good chance to take over each and every country with terrorists and terrorist groups.

We need a conservative American president to help secure the peace of Israel.


10 posted on 02/22/2011 5:48:43 PM PST by Mozilla
[ Post Reply | Private Reply | To 3 | View Replies]

To: FromLori

I DO NOT like where this is headed. Obama signing off on Egypt so early on gave these folks a green light.

I get a real hoot out of the protesters in Saudi Arabia stating they want women to get the vote. LMAO, are these folks truly that dumb, or is it just that they haven’t got a clue what these Imams are going to do to their income and rights?


11 posted on 02/22/2011 5:55:20 PM PST by DoughtyOne (Here's the proof of Obama's U. S. citizenship: " " Good enough for our 3 branches...)
[ Post Reply | Private Reply | To 9 | View Replies]

To: Mozilla
When these signs come down, I'll belive them.
12 posted on 02/22/2011 6:17:24 PM PST by clbiel (Hey Islam! Satan's on the line- says he's not giving back your religion without a fight.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: circlecity

This was maybe not orchestrated, but the situations availed to obama were not wasted.

Way back in the 1970’s, the democrat party started their assault on the oil industry. Windfall profits taxes. Never mind that there were years that the oil companies suffered losses and these profits flattened out the losses, but when Exxon made a profit at all, they were “evil”.

Exxon Valdez was a huge cause celeb for the anti American left to further restrict the oil companies business.

So, over the last 35 to 40 years, the feds have been trying to either nationalize or eliminate the private petroleum industry.

No drilling off the coast of California, Virginia, Florida or anywhere there is easily accessable oil. So the exploration is driven further and further offshore creating more and more risk.

Oil is known to be in great abundance in ANWR, but no, the environmentalists (dims) sue to keep the artic wasteland pristine. Again, restricting supply.

The BP rig blows down and the obama regime allows the situation to get out of control in order to shake down BP and further restrict drilling in the Gulf. Since the BP disaster, two permits have been issued to new drilling.

The dims have played around the edges of killing our domestic oil industry, but the obama team is going all out to make our country completely dependant on middle east oil. His subservient actions to the Saudi’s (bowing) was part of that.

Now we have a situation where islamists are threating to overtake the oil supplies in the Mid East and obama is loyal to their interests, not to this country. His actions speak to where his loyalties are.

In a nutshell, he is doing everything he can to make our country a dependant on the radical muslims who will control a major source of our energy sources.

Forcing wind and solar on the country where there is no infrastructure to support it. Denying permits for new coal mining. Denying permits for more drilling in the Gulf. Giving a huge pile of our cash to Petrobras (brazil) to expand their offshore drilling while shutting down our own domestic drilling.

It is starting to look like obama was selected for the job by the America hating demicrat party in order to accomplish just what he is doing.

There is NO Democrat politician who is publically disagreeing with what obama has done to this country and I doubt that there ever will.


13 posted on 02/22/2011 6:41:44 PM PST by Texas resident (Hunkered Down)
[ Post Reply | Private Reply | To 8 | View Replies]

To: Mozilla
Do not believe one damn word of it. The average Saudi is not hungry and he is not broke, bored with his wives maybe. The people that work in that country are Pakistani.
14 posted on 02/22/2011 6:42:48 PM PST by org.whodat
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith; AnonymousConservative; Berosus; bigheadfred; ColdOne; Convert from ECUSA; Delacon; ...

Thanks Mozilla.
they want the Cabinet reshuffled so that ministers' average age, now 65, is reduced to 40.
Hey, get over it -- the ancestor of the ruling class won. ;')


15 posted on 02/23/2011 4:46:12 PM PST by SunkenCiv (The 2nd Amendment follows right behind the 1st because some people are hard of hearing.)
[ Post Reply | Private Reply | View Replies]

To: Mozilla; SunkenCiv; gandalftb; Saberwielder
The most vociferous are tech-savvy youths

OK, but the most devoted are the unemployed Islamist youths, so what is the expected outcome?

http://frontpagemag.com/2011/02/21/cracks-in-the-kingdom/

16 posted on 02/23/2011 10:55:31 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson