Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Diagnosing What Ails North Korea's Kim Jong Il
ABC News ^ | 09/15/10 | JOOHEE CHO

Posted on 09/17/2010 9:14:28 PM PDT by TigerLikesRooster

Diagnosing What Ails North Korea's Kim Jong Il

Delay of Country's Congress Renews Question: Is Kim Jong Ill?

By JOOHEE CHO

SEOUL, South Korea, Sept. 15, 2010

North Korea abruptly postponed today what was billed as the country's largest political convention in 30 years, renewing speculation that the secretive country's supreme leader Kim Jong Il may be too sick -- possibly with diabetes -- to dominate the convention.

Experts have widely speculated that the meeting would be a way for Kim to promote his youngest son, Kim Jong Un, as his heir apparent.

But Good Friends, a welfare group based in Seoul, says the delegates from all over the nation are heading back to their hometowns after the convention was postponed "due to floods" and "due to lack of quorum."

The group, quoting a representative in Pyongyang who was waiting for the meeting to convene, said many participants could not travel to the convention "because the roads were disconnected by Typhoon Kompasu," which hit the nation on Sept. 2.

As if to back up the speculation, Pyongyang's official state media reported today that dozens of people were killed, 8,000 homes damaged, communications cut off, and railroads disconnected by the typhoon.

But most North Korean watchers in Seoul believe the real reason for the delay is either because the senior communist party officials could not reach an agreement regarding the role of heir apparent Kim Jong Un, or because Kim Jong Il's health is seriously deteriorating.

(Excerpt) Read more at abcnews.go.com ...


TOPICS: Foreign Affairs; News/Current Events
KEYWORDS: health; kimjongil; nkorea; noko; northkorea; partyconference
Navigation: use the links below to view more comments.
first 1-2021-4041-6061-64 next last
These days, amount of information defector organization has picked up went up drastically and speculation by outside experts(in S. Korea, Japan, and China) jumped dramatically as well.

These days, there are so much N. Korean information and expert's opinion out there that it literally make your head spin.

It does not help that N. Korea's state media is eerily quiet. No official announcement of delay by state media.

I think N. Koreans, both ordinary people and party officials, are more rattled by this than us. They know how to squeeze infomation by reading between the lines of ridiculous propaganda garbage spewed by state media.

They know what is not happening is frequently worse than what is.

1 posted on 09/17/2010 9:14:34 PM PDT by TigerLikesRooster
[ Post Reply | Private Reply | View Replies]

To: TigerLikesRooster

How does the son take over? Clearly the military cannot believe the DNA in that family tree is good for the people.


2 posted on 09/17/2010 9:21:41 PM PDT by FatherofFive (Islam is evil and must be eradicated)
[ Post Reply | Private Reply | To 1 | View Replies]

To: TigerLikesRooster
Diagnosing What Ails North Korea's Kim Jong Il

I don't care what ails this bastard, his death can't come to soon. One can only hope his successor has some compassion.

3 posted on 09/17/2010 9:26:50 PM PDT by doc1019 (Martyrdom is a great thing, until it is your turn.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: FatherofFive

“How does the son take over?”

If Lil’ Kim is dying, he will not.

Military might be waiting out Kim’s life. “Dear Leader, the roads are out! We cannot have a meeting!”

I imagine Lil’ Kim on his death bed asking why why why his son hasn’t been installed and he is told, “Dear Leader, we did not have a quorum” . HaHa.


4 posted on 09/17/2010 9:31:59 PM PDT by Shermy (Smoot Hawley caused the Depression, FDR saved us from the Depression. Two Big Lies.)
[ Post Reply | Private Reply | To 2 | View Replies]

To: TigerLikesRooster; All

Me so ronery!


5 posted on 09/17/2010 9:38:44 PM PDT by notdownwidems (Vote Republican! We're 1/10 of 1% better than the other guys!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: TigerLikesRooster

History tells us the bad live until someone makes them die.


6 posted on 09/17/2010 9:56:43 PM PDT by hadaclueonce ("Endeavor to persevere.")
[ Post Reply | Private Reply | To 1 | View Replies]

To: TigerLikesRooster

Almost time for Kim to fire up the spaceship


7 posted on 09/17/2010 10:02:44 PM PDT by ct_libertarian (Movie with a story or another Hollywood Marxist sermon? Find out at http://www.HollywoodSTFU.com)
[ Post Reply | Private Reply | To 1 | View Replies]

To: TigerLikesRooster; AmericanInTokyo; Steel Wolf; nuconvert; MizSterious; nw_arizona_granny; ...
Some of reported reasons for delay and my subjective rating

1) Heavy flood prevented many conference delegates from arriving in Pyongyang(lame excuse: flood is bad but not that bad.)

2) Heavy flood dampened the positive atmosphere in which the conference should convene. (lame excuse)

3) Party delegates, who are actually local party officials, have more pressing need to take care of flood damage. (lame excuse)

4) With outside aids having slowed to a trickle, the regime is short of gifts to give to delegates.(lame)

5) Security problems occurred in Pyongyang(rumors of anti-regime leaflets scattered in multiple places in Pyongyang near the scheduled date of conference: some account says it occurred twice with a couple of days apart.) (plausible)

6) The planned shake-up of top leadership ran into a trouble. Some are not happy to be downsized or pushed out (very plausible)

7) Kim Jong-eun has not earned enough credibility to be paraded as an official successor yet. Most of attempt to do so failed(currency reform, Cheonan sinking, World Cup fiasco, disastrous drive to build 10 million houses in Pyongyang.) (plausible)

8) Kim Jong-il’s health went bad (long-distance China trip and excessive effort to look healthy in public) (very plausible)

9) Party conference is a grand sting to ferret out moles within party ranks by leaking different information to different people. (implausible)

10) Impatient and overly aggressive Kim Jong-eun caused trouble again (rumor of him asking to be Chairman of National Defense Commission and Kim Jong-il to take a symbolic title of ‘Eternal Great Leader,’ which infuriated Kim Jong-il who then put a brake on party conference. Kim Jong-il decided to sit out the conference at his villa up north to show his anger. Kim Jong-il’s sister and his husband Jang Sung-taek hurriedly went to Kim Jong-il’s villa to cool him down. A rumor circulating in some quarters of N. Korea) (not credible)

11) Kim Jong-il had a second thought about his pledge to economic reform which he made at a meeting with Chinese leaders. It was said to be one of major agendas at the conference. He shelved the whole idea by delaying the conference. (plausible)

Odd development:

1) Carter said in his web site that he was told by Chinese Premier Wen Jiabao that Kim Jong-il denied his third son is groomed to be his successor, while there is another story that Kim Jong-eun accompanied Kim Jong-il in his trip to China in order to have a face-to-face introduction as the next top guy in N. Korea. Some S. Korean media reports that Kim Jong-eun’s photos are printed and distributed to senior officials, and soon unveiled to general public.

2) N. Korea is unexpectedly conducting major military exercise all over the country, in which special forces posing as hostile forces try to mount mock attack to strategically important locations while local militia and civilian brigades are supposed to defend sites against such attack. This is said to be the type of exercise they do in winter, but unusual to do it in autumn, right around the time of harvest. It would drain manpower for harvest and grains would not be fully harvested, which would worsen food shortage. Experts speculate that this was abruptly scheduled to divert attention from unexplained delay of party conference, and head off possible impression of regime instability among general public.

8 posted on 09/17/2010 10:06:41 PM PDT by TigerLikesRooster (The way to crush the bourgeois is to grind them between the millstones of taxation and inflation)
[ Post Reply | Private Reply | To 1 | View Replies]

To: doc1019

People who are crazier than an outhouse rat generally don’t live to a ripe old age.


9 posted on 09/17/2010 10:10:59 PM PDT by Pining_4_TX
[ Post Reply | Private Reply | To 3 | View Replies]

To: TigerLikesRooster
Correction: 10 million100K houses
10 posted on 09/17/2010 10:30:21 PM PDT by TigerLikesRooster (The way to crush the bourgeois is to grind them between the millstones of taxation and inflation)
[ Post Reply | Private Reply | To 8 | View Replies]

To: TigerLikesRooster

What ails him?! They can’t see the stick protruding from his buttocks?


11 posted on 09/17/2010 11:13:08 PM PDT by AJ504 (The Constitution was NOT written on an Etch-A-Sketch!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: TigerLikesRooster

12) Kim Jong-eun is in hospital.

South Korea’s conservative Chosun Ilbo daily on Saturday quoted an unidentified researcher at a state-financed institute saying that there was an unconfirmed intelligence report that the son has been hurt in an accident.

“There is an intelligence report that something happened to Jong-Un’s physical safety,” the researcher was quoted as saying.

http://www.google.com/hostednews/afp/article/ALeqM5inzT8nb8In0N0u93TG5lSrGMzlcQ


12 posted on 09/18/2010 3:32:40 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8 | View Replies]

To: TigerLikesRooster

No update on the North Korea’s Workers’ Party meeting since Sept 5 http://www.kcna.co.jp/index-k.htm


13 posted on 09/18/2010 3:38:11 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8 | View Replies]

To: AdmSmith

I saw that, too. If I add that to the list, it would in the “plausible” category.


14 posted on 09/18/2010 3:38:25 AM PDT by TigerLikesRooster (The way to crush the bourgeois is to grind them between the millstones of taxation and inflation)
[ Post Reply | Private Reply | To 12 | View Replies]

To: TigerLikesRooster

The plot thickens: is the sister of the dear leader prepared to step in?
http://news.chosun.com/site/data/html_dir/2010/09/18/2010091800360.html


15 posted on 09/18/2010 3:47:10 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14 | View Replies]

To: TigerLikesRooster

” unusual to do it in autumn, right around the time of harvest. It would drain manpower for harvest and grains would not be fully harvested, which would worsen food shortage”

Maybe with floods, etc there isn’t as much to harvest?


16 posted on 09/18/2010 3:53:20 AM PDT by nuconvert ( Khomeini promised change too // Hail, Chairman O)
[ Post Reply | Private Reply | To 8 | View Replies]

To: AdmSmith
This came out today. Another story to add more confusion on the situation.

It is difficult to assess who is capping whom. The only thing I am sure of is that Kim Jong-eun wants to cap many older guys, including his half-brother Kim Jong-nam living in Macau.

Kim Jong-eun apparently sees Jang Sung-taek and Kim Jong-nam as his political rivals. Not sure about Jong-eun's attitude toward Kim Kyong-hui, but Kim Kyong-hui is said to be partial to Kim Jong-nam. She is having more influence on Kim Jong-il these days. After all, she is his only blood sibling. Jang Sung-taek may have his own ambition. Military could be wary of Jang Sung-taek, fearing that his rise would undermine their power. It used to be that Jang's two brothers held top military posts which allowed Jang to maintain influence on military. They were purged by Kim Jong-il a few years ago. Now Jang has not much influence, as the story goes.

17 posted on 09/18/2010 4:10:24 AM PDT by TigerLikesRooster (The way to crush the bourgeois is to grind them between the millstones of taxation and inflation)
[ Post Reply | Private Reply | To 15 | View Replies]

To: nuconvert

Every grain counts in N. Korea.


18 posted on 09/18/2010 4:11:05 AM PDT by TigerLikesRooster (The way to crush the bourgeois is to grind them between the millstones of taxation and inflation)
[ Post Reply | Private Reply | To 16 | View Replies]

To: TigerLikesRooster; nuconvert

It is more than a full time job to keep tabs on what is happening now. We can probably expect something decisive within a month.


19 posted on 09/18/2010 4:15:52 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 17 | View Replies]

To: TigerLikesRooster; AmericanInTokyo; Jet Jaguar; monkapotamus; Cindy

HOw long before Number three son go KILL Bill Vol 1 on his relatives eh Tiger LOL!


20 posted on 09/18/2010 9:44:28 AM PDT by SevenofNine ("We are Freepers, all your media belong to us ,resistance is futile")
[ Post Reply | Private Reply | To 8 | View Replies]


Navigation: use the links below to view more comments.
first 1-2021-4041-6061-64 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson