Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

WikiLeaks founder uploads mystery file (WikiLeak Blackmails US and Blames US for Dead Informants)
New Europe ^ | July 31, 2010 | Andy Carling

Posted on 08/01/2010 2:55:37 AM PDT by tlb

Julian Assange has uploaded a file called “insurance” to the website and elsewhere. The file is 1.4 gigabytes, a thousand times larger than the recently leaked documents.

It is estimated that even the fastest computer would take millions of years to decrypt the file.

It is believed that Assange may have distributed the pass key to supporters, who could release it to the public.

The contents of the file are unknown. However, the recent release of documents, detailing the coalition’s experiences in Afghanistan, are not part of the 500,000 documents from Iraq, alleged to have been sent to WikLeaks by Bradley Manning.

Admiral. Mike Mullen, chairman of the Joint Chiefs of Staff, said that Assange and WikiLeaks may “already have on their hands the blood of some young soldier or that of an Afghan family.”

An angry Assange responded by asking “Why is the Pentagon focusing on the hypothetical blood on our hands, which has never been proved, rather than the real blood of the 20,000 deaths revealed in the documents?”

The top whistle blower, also criticized the US for “sloppy” and “unprofessional” security. WikiLeaks only uses code names internally for sources. Assange criticised the accessibility of the documents, saying, the information, including names of informants, “was available to every member of the U.S. military and every U.S. contractor — not just in Afghanistan — but all over the world. The military has acted in a disgraceful and careless way.”

Assange told reporters that he has plenty more material to be published, including “very significant” information on the BP oil spill and abuses in the US military, including sexual abuse.

In the meantime, the mystery file is being downloaded by many people, waiting for the key.

(Excerpt) Read more at neurope.eu ...


TOPICS: Crime/Corruption; Extended News; Government; Politics/Elections
KEYWORDS: assange; blackmail; files; insurance; julianassange; wikileaks
Navigation: use the links below to view more comments.
first previous 1-2021-4041-54 last
To: tlb
Julian Assange has uploaded a file called “insurance” to the website and elsewhere. The file is 1.4 gigabytes, a thousand times larger than the recently leaked documents.

It is estimated that even the fastest computer would take millions of years to decrypt the file.

Textbook example for a non sequitur.

The file size has absolutely nothing to do with how long it would take to break the encryption code. A 1kB file encrypted with the same key would take exactly as long to decrypt.

41 posted on 08/01/2010 10:35:10 AM PDT by Moltke (panem et circenses)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith
How could a 22-year old get TS clearance???

I held a TS w/SBI at 18.

42 posted on 08/01/2010 11:01:59 AM PDT by Petruchio
[ Post Reply | Private Reply | To 2 | View Replies]

To: Moltke

If the file is too short it can not be decrypted as there would be several possible solutions. In order to have a definite solution the corpus should have a certain minimum length.


43 posted on 08/01/2010 11:05:27 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 41 | View Replies]

To: AdmSmith

“Top Secret” clearances are a dime a dozen in our government. The recent Washington Post investigation revealed there are over 800,000 people who have them. What’s more absurd is that they are given for every job imaginable inside the federal beast - everything from an analyst at the Pentagon down to the guy who makes travel arrangements for the Department of Housing and Urban Development.


44 posted on 08/01/2010 11:52:06 AM PDT by conimbricenses (Red means run son, numbers add up to nothing.)
[ Post Reply | Private Reply | To 2 | View Replies]

To: AdmSmith

Yes, of course. 1kB was extreme just to make a point. Make it 1 MB or 10MB then.


45 posted on 08/01/2010 12:08:17 PM PDT by Moltke (panem et circenses)
[ Post Reply | Private Reply | To 43 | View Replies]

To: BushCountry

I take it you haven’t studied encryption.


46 posted on 08/01/2010 2:14:16 PM PDT by billybudd
[ Post Reply | Private Reply | To 4 | View Replies]

To: Rammer

Why? He’s exposing the inanity of this war, which the media and the military are trying to keep hidden. Sounds more like heroism than treason.


47 posted on 08/01/2010 2:19:27 PM PDT by billybudd
[ Post Reply | Private Reply | To 9 | View Replies]

To: billybudd

I don’t think any encryption algorithm is safe against a multi-million dollar supercomputer array system designed to crack encrypted files.

I don’t know what the dollar value is of the most advance technology the government current employs, but I know there are massively arrayed super-fast computers dedicated to breaking encryption. I doubt anything this guy used would be safe. Especially, since the story says he handed the key out to several people. There is no such thing as a secret if two if more than one person knows.


48 posted on 08/01/2010 2:36:01 PM PDT by BushCountry (I spoken many wise words in jest, but no comparison to the number of stupid words spoken in earnest)
[ Post Reply | Private Reply | To 46 | View Replies]

To: BushCountry
In any case, the purpose of the encryption in this case is not to prevent the government from seeing it, it's to prevent the media and general public from seeing it. The point is that his supporters will release the keys to the public so they can read the documents if he is killed by government agents.

He may have even sent a copy of the key to the government to let them know how damaging the documents are.
49 posted on 08/01/2010 4:45:40 PM PDT by billybudd
[ Post Reply | Private Reply | To 48 | View Replies]

To: AdmSmith; Ernest_at_the_Beach; ShadowAce; texas booster
The file is 1.4 gigabytes, a thousand times larger than the recently leaked documents. It is estimated that even the fastest computer would take millions of years to decrypt the file.
The estimate is from someone who has never used anything north of an abacus. :') Thanks AdmSmith!
50 posted on 08/01/2010 5:57:58 PM PDT by SunkenCiv ("Fools learn from experience. I prefer to learn from the experience of others." -- Otto von Bismarck)
[ Post Reply | Private Reply | To 2 | View Replies]

To: BushCountry

You watch way too much TV


51 posted on 08/01/2010 6:09:04 PM PDT by Pentak
[ Post Reply | Private Reply | To 48 | View Replies]

To: BushCountry
The man is either a stupid fool or writer has it wrong. No encryption software exists today that the government can’t break in a few days with their massively parallel arrayed decryption computers.

The government does not want this information to fall into the hands of our enemies. Anyone with a copy of the file and the key can release the decoded information on the internet.

52 posted on 08/02/2010 11:57:58 AM PDT by oldbrowser (Barack the Bungler must step down.)
[ Post Reply | Private Reply | To 4 | View Replies]

To: oldbrowser

I got a feeling there is some cloak and dagger activity happening to isolate the harm. And yea, I watch too much T.V. ;^)


53 posted on 08/02/2010 12:10:26 PM PDT by BushCountry (I spoken many wise words in jest, but no comparison to the number of stupid words spoken in earnest)
[ Post Reply | Private Reply | To 52 | View Replies]

To: billybudd

Exposing operational information that could get US armed forces personnel and our allies killed is not heroism. It is treason.


54 posted on 08/06/2010 8:09:09 AM PDT by Rammer
[ Post Reply | Private Reply | To 47 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-54 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson