Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Study Challenges View on Aging Research [amazing implications]
Univ. So. Cal. Newsroom ^ | 17 November 2005 | Carl Marziali

Posted on 11/18/2005 4:05:32 AM PST by PatrickHenry

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-38 last
To: VadeRetro

So maybe we could live six times as long if we forced our bodies into this extreme crisis mode and simulated starvation



I wish I had read this before lunch


21 posted on 11/18/2005 12:34:44 PM PST by Taffini (Mr. Pippin and Mr. Waffles do not approve)
[ Post Reply | Private Reply | To 12 | View Replies]

To: Taffini
I don't know. You diddle your genes and starve yourself.

Even if you only lived the same time, it would seem like six times as long. If you did live six times as long, it would seem like 36 times as long, or like you died and went to Hell.

22 posted on 11/18/2005 12:38:49 PM PST by VadeRetro (Liberalism is a cancer on society. Creationism is a cancer on conservatism.)
[ Post Reply | Private Reply | To 21 | View Replies]

To: PatrickHenry

Don't fall for it! It is an enviromentalists scheme to rid the earth of people. :-)


23 posted on 11/18/2005 12:45:12 PM PST by Mind-numbed Robot (Not all that needs to be done needs to be done by the government.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: VadeRetro

Even if you only lived the same time, it would seem like six times as long. If you did live six times as long, it would seem like 36 times as long, or like you died and went to Hell.




and worse, what if you lived 36x longer and it seemed like Hell as you say, then you died and actually went to hell...I call that loose, loose

I should have had the extra fries at lunch


24 posted on 11/18/2005 1:18:41 PM PST by Taffini (Mr. Pippin and Mr. Waffles do not approve)
[ Post Reply | Private Reply | To 22 | View Replies]

To: VadeRetro
I don't know. You diddle your genes and starve yourself.

Even if you only lived the same time, it would seem like six times as long. If you did live six times as long, it would seem like 36 times as long, or like you died and went to Hell.

I doubt that it'd actually feel like you were starving. I for one would take the pill. (As long as my body wasn't 6 times more frail than I would be at age 80 anyway!) But I don't think that's what happens in these cases. The very old animals in these tests look & act like they were in the prime of their lives, right up until the end.
25 posted on 11/18/2005 5:16:25 PM PST by jennyp (WHAT I'M READING NOW: Art of Unix Programming by Raymond)
[ Post Reply | Private Reply | To 22 | View Replies]

To: jennyp
You make it sound pretty good. I could cut down a little on the homages to the Flying Spaghetti Monster, but the beer and wine ration goes no lower!
26 posted on 11/18/2005 5:20:37 PM PST by VadeRetro (Liberalism is a cancer on society. Creationism is a cancer on conservatism.)
[ Post Reply | Private Reply | To 25 | View Replies]

To: VadeRetro
You make it sound pretty good. I could cut down a little on the homages to the Flying Spaghetti Monster, but the beer and wine ration goes no lower!

LOL, my 85-year old mom insists on a glass of good wine with dinner. But only because of the health benefits, of course. My 88-year old dad is happy to go along with that.

27 posted on 11/18/2005 5:25:12 PM PST by jennyp (WHAT I'M READING NOW: Art of Unix Programming by Raymond)
[ Post Reply | Private Reply | To 26 | View Replies]

To: jennyp
They must be doing OK. My Mom now 83 used to like a glass of wine in the evening but she's been totally prohibited for years after heart trouble, colon surgeries, etc. Lost Dad some years back at age 80 due to progressive heart failure.
28 posted on 11/18/2005 5:35:02 PM PST by VadeRetro (Liberalism is a cancer on society. Creationism is a cancer on conservatism.)
[ Post Reply | Private Reply | To 27 | View Replies]

To: PatrickHenry

Another article:

http://www.freerepublic.com/focus/f-news/1524957/posts?page=7#comment


29 posted on 11/18/2005 6:43:32 PM PST by phantomworker (A new day! Begin it serenely; with too high a spirit to be encumbered with your old nonsense!)
[ Post Reply | Private Reply | To 2 | View Replies]

Comment #30 Removed by Moderator

To: AGTTGTATTGAAAACACTATCTCAACG
I hope I never see the day when people can arbitrarily extend their life spans to many times their natural length.

No kidding. If you thought useless welfare deadbeats are bad now, just wait until its a "civil right" for them to hang around and leech off of the rest of us forever.

That's right about perpetuating the deadbeats of society!

I "had" to watch a movie on the plane yesterday morning, called "Island". They produced clones to replace organs and tissue of "real" people. Only cost $6 million per clone. But, wouldn't you know it, the clones revolted!!! ROFL!

31 posted on 11/18/2005 7:03:50 PM PST by phantomworker (A new day! Begin it serenely; with too high a spirit to be encumbered with your old nonsense!)
[ Post Reply | Private Reply | To 30 | View Replies]

To: spinestein
...if someone offered me a pill that would allow me to live to the age of 500 there is NO WAY I would take it.

Well, I understand completely. Seriously. When the time comes please ping me and I will be happy to take that pill off your hands!

32 posted on 11/18/2005 7:22:38 PM PST by AntiGuv (™)
[ Post Reply | Private Reply | To 18 | View Replies]

To: PatrickHenry

Cool! So I'm NOT wasting precious life on FR--there's so much more to come than I realized!


33 posted on 11/18/2005 7:24:55 PM PST by John Robertson ( Safe Travel)
[ Post Reply | Private Reply | To 1 | View Replies]

To: aimhigh
Not quite a validation of intelligent design . . .

Sure it is. When God created Adam and Eve, they lived for hundreds of years. Over time, due to sin, genetics deteriorated and shortened our life spans. There's no evidence here of accidental improvement in life span.

Oh please. The Bible is not a scientific paper. The Old Testament was written approximately 2500 years ago. There is no mention of evolution, airplanes, computers, or football. As Krauthammer wrote today, why do some people create a conflict between science and religion, when none need exist?

34 posted on 11/18/2005 11:34:31 PM PST by Maynerd
[ Post Reply | Private Reply | To 6 | View Replies]

To: AntiGuv

What would you envision yourself doing at the age of 450, assuming you would live naturally for a further 50 years after that?


35 posted on 11/20/2005 11:44:27 AM PST by spinestein (Forget the Golden Rule. Follow the Brazen Rule.)
[ Post Reply | Private Reply | To 32 | View Replies]

To: aimhigh
Sure it is. When God created Adam and Eve, they lived for hundreds of years. Over time, due to sin, genetics deteriorated and shortened our life spans.

Okay, I'll bite: How did "genetic deterioration" *add* a gene?

For that matter, how does "sin" cause "genetic deterioration"?

And how did "sin" add this same gene to most (perhaps all) eukaryotic organisms? Does "genetic deterioration" add the same gene to millions of life forms at the same time?

I think your thesis needs work.

36 posted on 11/20/2005 12:00:50 PM PST by Ichneumon
[ Post Reply | Private Reply | To 6 | View Replies]

To: spinestein; AntiGuv; PatrickHenry
What would you envision yourself doing at the age of 450, assuming you would live naturally for a further 50 years after that?

Yelling at those 300-year-old whippersnappers, telling them to get off my lawn!

37 posted on 11/20/2005 12:01:57 PM PST by Ichneumon
[ Post Reply | Private Reply | To 35 | View Replies]

To: spinestein; Ichneumon; PatrickHenry
What would you envision yourself doing at the age of 450, assuming you would live naturally for a further 50 years after that?

Debiting my universal account for whatever treatment will keep me alive 500 more.

38 posted on 11/20/2005 2:36:44 PM PST by AntiGuv (™)
[ Post Reply | Private Reply | To 35 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-38 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson