Free Republic
Browse · Search
General/Chat
Topics · Post Article


1 posted on 08/30/2024 6:20:08 PM PDT by SunkenCiv
[ Post Reply | Private Reply | View Replies ]


To: SunkenCiv

Enquiring minds want to know.


3 posted on 08/30/2024 6:31:04 PM PDT by know.your.why
[ Post Reply | Private Reply | To 1 | View Replies ]

To: SunkenCiv

They also found that she probably had dark skin, dark hair, and blue eyes...
~~~~~~~~~~~~~~

Quite an intriguing combo...


4 posted on 08/30/2024 6:33:31 PM PDT by Yardstick
[ Post Reply | Private Reply | To 1 | View Replies ]

To: SunkenCiv

5 posted on 08/30/2024 7:04:15 PM PDT by Secret Agent Man (Gone Galt; not averse to Going Bronson.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: SunkenCiv
She was genetically more closely related to hunter-gatherers from the mainland Europe than to those who lived in central Scandinavia at the time. They also found that she probably had dark skin, dark hair, and blue eyes...

She sounds hot!

6 posted on 08/30/2024 7:10:06 PM PDT by TigersEye (His son nicknamed him Pedo Pete. (mic drop))
[ Post Reply | Private Reply | To 1 | View Replies ]

To: SunkenCiv

She kept her mouth in shape with all that chewing...I bet she was popular.


8 posted on 08/30/2024 7:28:04 PM PDT by Az Joe (Live free or die)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: SunkenCiv

Determined their chewing gum sucked wind as bad as ours today.

Bazooka, it died with bazooka.


10 posted on 08/30/2024 7:39:38 PM PDT by If You Want It Fixed - Fix It
[ Post Reply | Private Reply | To 1 | View Replies ]

To: SunkenCiv

I have been spitting my gum into the storm drain at work nearly every day, coming and going, for years. There has to be several thousand pieces down there. I wonder what future anthropologist will make of it. When I retire I’m tempted to toss in something like a naked Barbie holding a machete so they can debate whether it’s a fertility, harvest, or war shrine.


15 posted on 08/31/2024 4:39:33 AM PDT by Farmerbob
[ Post Reply | Private Reply | To 1 | View Replies ]

To: SunkenCiv

They could have saved time by checking the soles of their moccasins....


16 posted on 08/31/2024 4:51:15 AM PDT by Hot Tabasco
[ Post Reply | Private Reply | To 1 | View Replies ]

To: SunkenCiv
That was from 2019, in 2024 this article was published “Population genomics of post-glacial western Eurasia”

Fig. 6: Genetic relatedness across western Eurasia.

Maps showing networks of highest IBD sharing (top 10 highest sharing per individual) during different time periods for 579 imputed genomes predating 3,000 cal. bp (calibrated years before present) and located in the geographical region shown. Shading and thickness of lines are scaled to represent the amount of IBD shared between two individuals. In the earliest periods, sharing networks exhibit strong links within relatively narrow geographical regions, representing predominantly close genetic ties between small HG communities, and rarely crossing the East–West divide extending from the Baltic to the Black Sea. From around 9,000 cal. bp onwards, a more extensive network with weaker individual ties appears in the south, linking Anatolia to the rest of Europe, as early Neolithic farmer communities spread across the continent. The period 7,000–5,000 cal. bp shows more connected subnetworks of western European and eastern/northern European Neolithic farmers, while locally connected networks of HG communities prevail on the eastern side of the divide. From c. 5,000 bp onwards the divide finally collapses, and continental-wide genetic relatedness unifies large parts of western Eurasia.

IBD https://en.wikipedia.org/wiki/Identity_by_descent

it is open access https://www.nature.com/articles/s41586-023-06865-0

17 posted on 08/31/2024 5:13:16 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson