Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

How to raise the world’s IQ
The Economist ^ | Jul 11th 2024 | The Economist

Posted on 07/11/2024 12:37:56 PM PDT by JSM_Liberty

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-4041 next last
To: JSM_Liberty

“Another method is to give small sums of money to poor families with infants or pregnant mothers. Handing out cash is better than handing out food itself. It is more flexible—it can be spent on medicine as well as food.”

We give sums of money and food to poor single moms. It hasn’t worked out so well.

I’m surprised The Economist didn’t recommend that we offer money to youths who get bad grades and score low on aptitude tests.


21 posted on 07/11/2024 1:09:15 PM PDT by ChessExpert (Scarborough: "This is the Best Biden ever.")
[ Post Reply | Private Reply | To 1 | View Replies]

To: JSM_Liberty

Related:

The average IQ in the USA is 98

Take this IQ test and check what is your IQ

https://wwiqtest.com/


22 posted on 07/11/2024 1:25:46 PM PDT by Jyotishi (Seeking the truth, a fact at a time.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Reno89519

Expel students who are behavior problems and send them to vocational training of some kind. If they don’t want education and want to work, kick them out.

Expel illegals.

No anchor babies.

Schools would actually mean something.


23 posted on 07/11/2024 1:26:45 PM PDT by MeanWestTexan (Sometimes There Is No Lesser Of Two Evils)
[ Post Reply | Private Reply | To 4 | View Replies]

To: JSM_Liberty
People today are much cleverer

Except for the people who wrote this stuff.

"Cleverer"? Really?

24 posted on 07/11/2024 1:28:39 PM PDT by grobdriver (The CDC can KMA!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: JSM_Liberty

That’s pretty hard to believe after watching a few YouTube videos of questions asked at Harvard, other schools, and on the street asking young people “tough questions” like: “How many states are there?”, “How much is 3x3x3”, “Name a state that starts with the letter ‘K’”, “Point to China on a map”, etc.


25 posted on 07/11/2024 1:29:11 PM PDT by libertylover (Our biggest problem, by far, is that almost all of big media is AGENDA-DRIVEN, not-truth driven.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: JSM_Liberty

Easy. kill every arab, and you’ll see a significant increase in global IQ.


26 posted on 07/11/2024 1:45:47 PM PDT by zeugma (Stop deluding yourself that America is still a free country.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: grobdriver

— “Cleverer”? Really?

It is the comparative adjective of clever.


27 posted on 07/11/2024 1:51:34 PM PDT by JSM_Liberty
[ Post Reply | Private Reply | To 24 | View Replies]

To: JSM_Liberty

IQ is a measure against the average, so if everyone in the world became significantly smarter, the average IQ would still be 100.


28 posted on 07/11/2024 1:54:37 PM PDT by Mr. Mohasky (Common sense in a world lacking any, will be perceived & construed as an extreme point of view.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: JSM_Liberty

Cleverer? That’s a word? I’m not sure the writer’s IQ improved.


29 posted on 07/11/2024 2:49:50 PM PDT by VTenigma (Conspiracy theory is the new "spoiler alert")
[ Post Reply | Private Reply | To 1 | View Replies]

To: JSM_Liberty

Encourage the Democrats’ efforts to seek abortions?


30 posted on 07/11/2024 3:15:08 PM PDT by Savage Beast (Trump defeated the entire Philistine Army using the jawbone of an ass, the ass being Joe Biden.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: RckyRaCoCo

Encourage homosexuality among Democrats?


31 posted on 07/11/2024 3:15:57 PM PDT by Savage Beast (Trump defeated the entire Philistine Army using the jawbone of an ass, the ass being Joe Biden.)
[ Post Reply | Private Reply | To 11 | View Replies]

To: JSM_Liberty
How could it improve so rapidly over just a few decades? The answer is largely that people were becoming better nourished and mentally stimulated.

I disagree. I think it's because the Western world lowered its standards precipitously in that time period. Hence, even the testing has been dumbed down.

32 posted on 07/11/2024 3:57:01 PM PDT by Albion Wilde (Either ‘the Deep State destroys America, or we destroy the Deep State.’ --Donald Trump)
[ Post Reply | Private Reply | To 1 | View Replies]

To: JSM_Liberty

“Genocide”

(requires definition change; right up their alley)

Frankly, this one I’d be good with.


33 posted on 07/11/2024 4:03:28 PM PDT by logi_cal869 (-cynicus the "concern troll" a/o 10/03/2018 /!i!! &@$%&*(@ -)
[ Post Reply | Private Reply | To 1 | View Replies]

To: JSM_Liberty

IQ?
...go look at how that is measured...
(ridiculous)


34 posted on 07/11/2024 4:04:34 PM PDT by Repeal The 17th (Get out of the matrix and get a real life.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: rightwingcrazy

“:...We’re sorry, the page you requested is not found.
The URL may be misspelled or the page you’re looking for
is no longer available....”


35 posted on 07/11/2024 4:06:43 PM PDT by Repeal The 17th (Get out of the matrix and get a real life.)
[ Post Reply | Private Reply | To 5 | View Replies]

To: JSM_Liberty

Get rid of all the take this pill for this and that commercials.


36 posted on 07/11/2024 4:19:23 PM PDT by LastDayz (A blunt and brazen Texan. I will not be assimilated.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: JSM_Liberty

It doesn’t have anything to do with poverty and nourishment.

It has everything to do with being around smart people. Not necessarily people who know a lot of things. Smart people.

(Aside from the flaw in thinking implied in the title: “Average” is not a constant. The average itself gets higher when more people get smarter, obviously. It’s a wonderful continuously self-fulfilling phenomenon. To be of above average intelligence today is a whole different thing from being above average 50 years ago.)


37 posted on 07/11/2024 4:49:13 PM PDT by firebrand
[ Post Reply | Private Reply | To 1 | View Replies]

To: JSM_Liberty

Bring low IQ folks here and our moron-taught children will be grand LEADERS....like Willard’s Master of all those rats.


38 posted on 07/12/2024 12:35:09 AM PDT by If You Want It Fixed - Fix It
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith; AnonymousConservative; Arthur Wildfire! March; Berosus; Bockscar; BraveMan; cardinal4; ...
It has to do with childhood nutrition, it sez here.

39 posted on 07/12/2024 5:04:11 AM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | View Replies]

To: SunkenCiv

Stop this:

A report by the Dubai-based Centre for Arab Genomic Studies (CAGS) in September 2009 found that Arabs have one of the world’s highest rates of genetic disorders, nearly two-thirds of which are linked to consanguinity.

A 2009 study found that many Arab countries display some of the highest rates of consanguineous marriages in the world, and that first cousin marriages which may reach 25–30% of all marriages. In Qatar, Yemen, and UAE, consanguinity rates are increasing in the current generation. Research among Arabs and worldwide has indicated that consanguinity could have an effect on some reproductive health parameters such as postnatal mortality and rates of congenital malformations.

https://en.wikipedia.org/wiki/Cousin_marriage


40 posted on 07/12/2024 5:31:13 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 39 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson