Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Update from Ukraine | Wagner started the military coup in Ruzzia | Prygozhyn is going to Moscow
Youtube.com ^ | 6-23-2023 | Denys Davydov

Posted on 06/23/2023 5:49:31 PM PDT by UMCRevMom@aol.com

Update from Ukraine | Wagner started the military coup in Ruzzia | Prygozhyn is going to Moscow

https://www.youtube.com/watch?v=ZMtjavd5Sug

The summary of the situation of Russian re-invasion to Ukraine covering the last 48 hours, as of 22nd June 2023 – 22:00 (Kyiv time).

https://militaryland.net/news/invasion-day-484-summary/

*** Great interactive map with viewer controlled Map magnification tool to use for each Front!

https://militaryland.net/maps/


TOPICS:
KEYWORDS: globalistpropaganda; poordoomedwangers; prayfordoomedwangers; prigozhin; ramzankadyrov; reportfordutydenys; russia; russianinvasion; sergeyshoigu; thewangergroup; turkey; ukraine; wagnergroup; wangergroup; whenpigsfly; wingywangers; wonderfulwangers; yevgenyprigozhin; youtubebloodmoney
Navigation: use the links below to view more comments.
first previous 1-20 ... 81-100101-120121-140141-149 next last
To: Peter ODonnell; MalPearce; Organic Panic; UMCRevMom@aol.com

I suspect Prigozhin would rather be killing Africans and getting rich, than killing people who have friends and some family in Russia, and frequently speak Russian as well as Ukranian.

On the other hand if he can work out a deal to withdraw Russian troops and reduce the amount of money held in the West (around $300 billion) for reparations, there will be fortunes to be made with reconstruction contracts in Ukraine. I wonder how many Russian oligarchs and are drooling at the thought of working construction deals, especially in regions that were somewhat favorable to Russia before this big mess. These Russians would not even have to go to Ukraine, just manipulate funding to be managed by people hired within Ukraine. Entire cities like Mariupoland Bakhmut need to be rebuilt, not to mention all the major repair projects and demolition work needed. Trump understands how that segment of the economy works.


121 posted on 06/24/2023 1:37:29 AM PDT by gleeaikin (Question authority!.)
[ Post Reply | Private Reply | To 119 | View Replies]

To: struggle; Travis McGee

Isn’t it amazing how these suckers fall for this stuff over and over?

Consider not too long ago this Wagner guy publicly complaining about having no ammo and it was all a trap for the Ukraine forces.

And this is the same thing and yet again these same people fall for it.

And you know why it’s all one big trap for Ukraine? Consider that even government news sources in Russia like RT, Sputnik and TASS are all talking this “oh no we might have a civil war” stuff. THAT right there is proof this is all one big bait.


122 posted on 06/24/2023 2:03:29 AM PDT by MoonlightMouse
[ Post Reply | Private Reply | To 18 | View Replies]

To: MoonlightMouse

So you reckon two entire regions east of occupied LDPR have been taken over with barely any effort in one day by a force that took months to capture one small city...

Leaving occupied Donbas as the filling in a sandwich, cut off from resupply and reinforcement unless Wagner stands down...

https://freerepublic.com/focus/f-news/4163086/posts?page=86#86

And rather than “we’re out of ammo” being the bait, you think their revolt is the bait?

Twenty five dimensional chess is needed there, or wishful thinking, or desperation, or rank stupidity.

It’s the Putinists who are the real suckers. Wagner and the military leadership are obviously fighting each other, and the defense of the occupation of south Ukraine will be less important to Moscow than resolving that split.

Maybe Putin will agree with Prighozin that all mistakes can be pinned on the generals and the Ministry. Maybe he’ll side with Shiogu.

But either way he’s got a serious conflict between military leads that jeopardises the SMO.


123 posted on 06/24/2023 2:19:59 AM PDT by MalPearce ("You see, but you do not observe". https://www.thefabulous.co/s/2uHEJdj)
[ Post Reply | Private Reply | To 122 | View Replies]

To: MoonlightMouse

I don’t see how this works as “bait”.
Who are they trying to bait, and into what?

Baiting the Ukes to attack some more? They are going to do that anyway. If the Russians run away, then they are going to advance until the Russians stop running.

One cost of this is extremely bad PR for Russia, internally as well as externally. Russia looks rickety, unstable.


124 posted on 06/24/2023 2:29:48 AM PDT by buwaya (Strategic imperatives )
[ Post Reply | Private Reply | To 122 | View Replies]

To: AdmSmith; AmericanInTokyo; amnestynone; Apparatchik; AZJeep; babble-on; TheBattman; BeauBo; bert; ..

VIDEO WITH SUMMARIZED COMMENTARY

23 Jun: RUSSIANS KILL EACH OTHER IN A SUDDEN VIOLENT COUP | War in Ukraine Explained
309K views
6-24-2023 2:30 a.m. EDT
https://www.youtube.com/watch?v=fmITp1Kz1yU

⚠️ Watch RFU in 18+ languages: https://www.youtube.com/@RFU/channels

I am Ukrainian. My country has been invaded by Russia. In this video I will tell you what happened on the four hundred and eighty fifth day of the war.

Day 485: Jun 23

Today there was an insane sequence of events that ended up with the Head of the biggest Russians private military company, the Wagner Group, Prigozhin, starting a coup on the territory of the Russian Federation and declaring that his goal is to remove the Russian Defense Minister, Shoigu, and the Chief of the General Staff, Gerasimov, and that anyone who stands in his way will be destroyed.

The day started with the release of an exclusive interview with Prigozhin, where he raised the most uncomfortable questions, exposed the biggest lies told by the highest Russian officials, and revealed the terrifying reality of the war.

In particular, he exposed the fact that the main reason why Russia started the war is that, firstly, the Russian Defense Minister, Shoigu, wanted to go down in history as a Marshal and a two-times Hero of the Russian Federation, and secondly, because the Russian elite wanted to usurp Ukrainian assets.

4 hours later, Prigozhin published a video showing that Wagner forces’ camps in the deep rear suffered a terrible strike. He claimed that Shoigu, who recently visited the Rostov region, did so in order to personally command the special operation to destroy Wagner forces.

He claimed that their camps were hit with rockets and artillery and then raided by assault helicopters. Prigozhin said that he was gathering all his forces and heading toward Moscow to wipe out the Russian Ministry of Defense.

In response, the Russian Ministry of Defense effectively launched a criminal investigation for instigation of a coup, threatening Prigozhin with up to 20 years in prison; they effectively seized Wagner’s centers in Saint Petersburg; and forbade all media channels to even mention Prigozhin’s claims and declarations.

Prigozhin did not back down, there was a hacker attack on Russian channels, which started translating Prigozhin’s announcement that he was heading to Moscow.

The Russian Ministry realized that this was getting serious, shut down the internet in some regions, set ready all their special forces, such as Rosgvardia, Grom, and SOBR, closed the border with the Luhansk and Donetsk regions, closed the highways, enacted the Fortress Plan, and started building fortifications on the roads to meet and destroy the Wagner forces.

The streets in the Russian cities were gradually filled with heavy equipment for direct and heavy confrontations. As a last desperate move, the Russian Ministry of Defense released a series of appeals to the Wagner soldiers: at first, the videos featured many different regular Russian formations along the whole front line who asked Wagner to return to the front; then they used Prigozhin’s friend – general Surovikin – to ask Prigozhin to stop, and finally, they even asked the Deputy Chief of the General Staff, Alekseev, who helped Prigozhin to establish his private military company, to stop before it is too late.

Prigozhin claimed that despite the Ministry’s orders, they passed the border and initial block posts with no hurdles because the oppressed Russian soldiers were reportedly happy that someone was finally going to push back. He asked others to do the same because whoever stood in their way would be destroyed.

Next, the Russian Ministry of Defense ordered to conduct an airstrike on the Wagner’s convoys, which had already entered the Rostov region, and Prigozhin claimed that they shot down several helicopters. Later, videos emerged of direct confrontation between the regular Russian detachments and Wagner forces.

Eventually, the Wagner forces prevailed and continued their movement. Locals continued releasing footage of Wagner columns passing through the region, where Wagner forces were moving all types of weapons: from machine guns, drone launchers, and mortar systems to tanks and artillery.

Soon, this equipment was used to seize their first target – the headquarters of the Southern Military District, which commands 70 thousand soldiers. Wagner forces surrounded the building with tanks and blocked the movement. Later they also seized police stations, Federal Security Services, and regional administration, effectively ceasing control over the whole Rostov region.

Right now, the Wagner forces have just entered the Voroniezh region. Locals are posting videos with audible gunfire. In the meantime, the Russian Ministry of Defense is reinforcing Moscow.

*** Select the 3 horizontal dots to view the Complete Transcript [Below video/ top right corner]


125 posted on 06/24/2023 3:41:23 AM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasion)
[ Post Reply | Private Reply | To 108 | View Replies]

To: UMCRevMom@aol.com

Perhaps this is a 3 day operation ;-)


126 posted on 06/24/2023 3:56:42 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 125 | View Replies]

To: AdmSmith

Note to Vlad....there will be no attack it’s just a Wagner training exercise.


127 posted on 06/24/2023 4:27:58 AM PDT by rbmillerjr (Trump's lies about Cuomo being better than DeSantis on Covid is DISQUALIFYING....)
[ Post Reply | Private Reply | To 126 | View Replies]

To: UMCRevMom@aol.com
Meanwhile in an undisclosed location
128 posted on 06/24/2023 4:29:51 AM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasion)
[ Post Reply | Private Reply | To 125 | View Replies]

To: UMCRevMom@aol.com

LOL...que the picture of Pooty Poot riding a horse with no shirt.


129 posted on 06/24/2023 4:30:41 AM PDT by rbmillerjr (Trump's lies about Cuomo being better than DeSantis on Covid is DISQUALIFYING....)
[ Post Reply | Private Reply | To 128 | View Replies]

To: AdmSmith

130 posted on 06/24/2023 4:33:55 AM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasion)
[ Post Reply | Private Reply | To 126 | View Replies]

To: rbmillerjr; AdmSmith

131 posted on 06/24/2023 4:36:21 AM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasion)
[ Post Reply | Private Reply | To 129 | View Replies]

To: rbmillerjr; AdmSmith

Civilians live-streaming the Wagner Group’s assault on the headquarters of the Russian Defense Ministry in Rostov.
Historic footage!

https://www.facebook.com/100093657367773/videos/1589700874854576/


132 posted on 06/24/2023 4:58:59 AM PDT by UMCRevMom@aol.com (Pray for God's intervention to stop Putin's invasion)
[ Post Reply | Private Reply | To 131 | View Replies]

To: UMCRevMom@aol.com

They shouldn’t be that close it’s not a movie shoot.


133 posted on 06/24/2023 5:29:48 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 132 | View Replies]

To: Kazan

Probably much better today now that your Russia army is fighting on two fronts :D


134 posted on 06/24/2023 6:27:47 AM PDT by Boogieman
[ Post Reply | Private Reply | To 4 | View Replies]

To: Travis McGee

On the contrary, it is folks like you, who have now been exposed as spreading fake Russian propaganda for over a year, who now look as gullible as the Qtards.


135 posted on 06/24/2023 6:32:40 AM PDT by Boogieman
[ Post Reply | Private Reply | To 16 | View Replies]

To: UMCRevMom@aol.com

“the Russian Armed Forces “continue to perform combat missions on the contact line against the Ukrainian Armed Forces”

At least until they run out of ammo and can’t resupply because Wagner is between them and their logistics.


136 posted on 06/24/2023 6:36:14 AM PDT by Boogieman
[ Post Reply | Private Reply | To 17 | View Replies]

To: Travis McGee

Let’s wait and see what the map looks like after Russia’s been fighting on two fronts for a couple weeks with no means of resupply :D


137 posted on 06/24/2023 6:40:19 AM PDT by Boogieman
[ Post Reply | Private Reply | To 41 | View Replies]

To: struggle

Sure, that’s just what Russian needs to stop a general rebellion. Start bombing its own civillians :D


138 posted on 06/24/2023 6:41:59 AM PDT by Boogieman
[ Post Reply | Private Reply | To 40 | View Replies]

To: Kazan
How much food and fuel does the Russian front line have? They will abandon their positions before those run out.

I give it 72 hours before they hit the roads and retreat from Ukraine.

We already know what a KGB army looks like when its food and fuel run out.


139 posted on 06/24/2023 6:57:05 AM PDT by Justa (If where you came from is so great then why aren't Floridians moving there?)
[ Post Reply | Private Reply | To 4 | View Replies]

To: Kazan
Yeah mom, what the buzz?

Tell us whats happening with your Ukrainian homies.

140 posted on 06/24/2023 7:00:45 AM PDT by jmacusa (Liberals. Too stupid to be idiots. )
[ Post Reply | Private Reply | To 4 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 81-100101-120121-140141-149 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson