Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Coronavirus Live Weekend Thread.
2/22/20

Posted on 02/22/2020 7:03:34 AM PST by Vermont Lt

click here to read article


Navigation: use the links below to view more comments.
first previous 1-20 ... 181-200201-220221-240 ... 741-750 next last
To: blueplum
People's Daily, China‏Verified account @PDChina

China's Gansu Province and Liaoning Province have downgraded their public health emergency response from the highest level to level three, according to local government. The adjustment for these 2 low-risk areas makes sure production and transportation return normal.

YAY! Those lucky Chinese who have a communist government that won't risk their lives for profit- like capitalists would...

201 posted on 02/22/2020 12:40:28 PM PST by mrsmith (Dumb sluts (M / F) : Lifeblood of the Media, Backbone of the Democrat/RINO Party!)
[ Post Reply | Private Reply | To 200 | View Replies]

To: janetjanet998
The research center is 20 miles from Market Place

My Speculation: Patient zero work at the Virus research center just down the street from the seafood market. Patient Zero got infected researching at the center. Patient Zero would have lunch regular at the market place.

Note: SARS virus has escaped this lab before
202 posted on 02/22/2020 12:44:57 PM PST by DEPcom
[ Post Reply | Private Reply | To 189 | View Replies]

To: blueplum

So the uncollected bodies are still there since the 49 crematoriums running 24/7 could not keep up and the ccp just brought in incinerators to use for other purposes - makes sense, since there is no problem with internal political security. Likely the only bodies being cremated are the usual 50 or so a day, and the uncollected bodies are the many under 40 people

yep just the ordinary seasonal flu - move along


203 posted on 02/22/2020 12:46:39 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 159 | View Replies]

To: Black Agnes

your guys must be a different bunch from mine


204 posted on 02/22/2020 12:47:52 PM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 138 | View Replies]

To: grey_whiskers

not ready to buy the bioweapon theory

trigger warning: do not read the linked article if you’re an anti-vaxxer and don’t flame me, I’m only pointing to data, not the article:

that said - scroll all the way down past the article and most comments to the Feb 7 post by Extended Vacation, to get to his sequencing comparison between Wuhan, Bat and Sars. In short: SARS: YLNTY Virus: LFQNY Bat isolate: LLYDH

Why he feels this is a nature-derived virus:

“There is an alignment with pShutttle-SN for both the circulating virus and the bat faeces virus but it is almost entirely within the S spike region. Furthermore, the S spike in pShuttle-SN is truncated and there is a SARS S spike which is a much better match for both. So the vast majority of the pShuttle-SN match is explained by a natural common ancestor with the SARS S spike. There is a very small section which matches prior to the S spike (somewhere around 21517). I did another search for this “AGAGTTGTTATTTCTAGTGATGTTCTTGTTAACA” and I think it’s part of Replicase 1B — another natural match.

I then took a look at the receptor binding domain which according to the paper “Isolation and characterization of a bat SARS-like coronavirus that uses the ACE2 receptor” has five “key amino acids residues involved in interacting with human ACE2 molecule”. I guessed that if you wanted to engineer the virus to be more SARS like you’d want to change these to be identical to the ones in SARS. The SARS five are YLNTY. The circulating virus has LFQNY and the bat isolate has LLYDH. I’m not sure if the framing is right in my analysis here but nothing looks suspicious to me.

I also googled “CTCCTCGGCGGG” which is a small insert difference and found a short article by Bill Gallaher which indicates this doesn’t look engineered either.

I’n my earlier posts I had misremembered the meta-data of the bat isolate. It’s the same one collected in 2013 that other people are reporting, not from 2014 as I wrote previously.

Notes are below if you want to check them. You will need to copy and paste into a monospace font to get the VVVs to point to the five key amino acids.”
https://respectfulinsolence.com/2020/01/31/2019-ncov-wuhan-outbreakdue-to-failed-coronavirus-vaccine/


205 posted on 02/22/2020 12:54:13 PM PST by blueplum ( ("...this moment is your moment: it belongs to you... " President Donald J. Trump, Jan 20, 2017))
[ Post Reply | Private Reply | To 167 | View Replies]

To: mrsmith

Iran

Tehran City Council In Limbo After District Mayor Diagnosed With Coronavirus
February 22, 2020
Radio Farda

The meetings of Tehran City Council may be cancelled after the mayor of one Tehran’s 22 districts was diagnosed with coronavirus on Saturday.

The Mayor of District 13 of Tehran, Mojtaba Rahmanzadeh, already had meetings with several officials, including the Chairman of the Council Mohsen Hashemi, in the past few days before testing positive for the virus.

In a tweet on Saturday Hashemi said he was staying home and was going to go to hospital to be tested although he does not have any symptoms of coronavirus infection. Other members of the Council will also be tested for the virus, he said in his tweet.

https://en.radiofarda.com/a/30448789.html


206 posted on 02/22/2020 12:56:59 PM PST by LilFarmer
[ Post Reply | Private Reply | To 201 | View Replies]

To: blueplum
It's not the vaccine itself but

a) the dense-pack of dosing
b) the metal adjuvants

207 posted on 02/22/2020 12:57:23 PM PST by grey_whiskers (The opinions are solely those of the author and are subject to change with out notice.)
[ Post Reply | Private Reply | To 205 | View Replies]

To: LilFarmer

Iran - 5th death

These decisions come a few hours after the authorities announced a fifth death from the new coronavirus, as well as 10 new cases, bringing the total number of infected people in the Islamic Republic to 28.

“We have ten new confirmed cases of Covid-19,” health ministry spokesman Kianouche Jahanpour said on state television on Saturday.

“One of the 10 infected people unfortunately died,” he added.

Mr. Jahanpour did not specify the nationality of the five deceased people.

https://www.afp.com/fr/infos/334/coronavirus-liran-enregistre-le-plus-grand-nombre-de-deces-dans-un-pays-hors-extreme-orient-doc-1p77pj11


208 posted on 02/22/2020 12:59:27 PM PST by LilFarmer
[ Post Reply | Private Reply | To 206 | View Replies]

To: LilFarmer

“Mohsen Hashemi”

He is the son of former President of Iran, Rafsanjani


209 posted on 02/22/2020 1:06:45 PM PST by nuconvert ( Warning: Accused of being a radical militarist. Approach with caution.)
[ Post Reply | Private Reply | To 206 | View Replies]

To: Black Agnes

Local drug store near me was bare bones on cold and flu meds. A couple pack of aspirins and such but stripped bare compared to what I’ve experienced there before.
They did not have what I went there for.


210 posted on 02/22/2020 1:09:05 PM PST by TermLimits4All (A coup on the people's President, will result in bloodshed. Be prepared always.)
[ Post Reply | Private Reply | To 197 | View Replies]

To: nuconvert

That’s a big deal, he was a VIP.


211 posted on 02/22/2020 1:10:09 PM PST by SE Mom (Screaming Eagle mom)
[ Post Reply | Private Reply | To 209 | View Replies]

To: LilFarmer
Japan update With this announcement, there are 132 domestically infected people (113 patients, 16 asymptomatic pathogen carriers, 3 confirmed positive). https://www.mhlw.go.jp/ One of the quarantine officers at the Otaru Quarantine Station Chitose Airport Quarantine Station was suspected of a new type of coronavirus infection. It turned out.  The person has already been hospitalized and started treatment.  We will carry out proactive epidemiological investigations on this matter, including the identification of close contacts. https://www.mhlw.go.jp/index.html
212 posted on 02/22/2020 1:13:23 PM PST by LilFarmer
[ Post Reply | Private Reply | To 208 | View Replies]

To: nuconvert; All

Hector Torres
@hectorology
Reports that Iranian Brigadier General in the Islamic Revolutionary Guard Corps (IRGC) and commander of the Quds Force infected with #COVID19


213 posted on 02/22/2020 1:17:31 PM PST by SE Mom (Screaming Eagle mom)
[ Post Reply | Private Reply | To 209 | View Replies]

To: PIF

no, what I’m saying is, there is more than one reason to bring in incinerators.

Right now, china has bird flu, swine fever, dead livestock from lack of forage deliveries, dead birds, dead pigs, they’re crawling in bats and crows (crows eat carrion and spread disease) rotten vegetables that can’t be transported, two month’s worth of household trash, and all the lovely things a plague brings with it besides just bodies.

And, China is making a huge show right now of nationalism and superiority - of look what we can build and how fast we can build it in spite of a pandemic. And they’ve wanted to build that waste-to-energy plant for 8 months now - the reason for the protests back in July. Overworked crematoriums didn’t stop them from building a popup hospital, right? The Chinese don’t think like we do.


214 posted on 02/22/2020 1:21:16 PM PST by blueplum ( ("...this moment is your moment: it belongs to you... " President Donald J. Trump, Jan 20, 2017))
[ Post Reply | Private Reply | To 203 | View Replies]

To: janetjanet998

https://mobile.twitter.com/Iran_NewsRoom/status/1223624213426249731

From that same source. I call history revisal on Iran and it’s quarantine. The article I read back then, late , January implied no special handling. The pictures on that link attest to it.

I think Iran is in CYA


215 posted on 02/22/2020 1:22:21 PM PST by winoneforthegipper ("If you can't ride two horses at once, you probably shouldn't be in the circus" - SP)
[ Post Reply | Private Reply | To 151 | View Replies]

To: SE Mom

That would be Ghaani - he is the replacement for Soleimani


216 posted on 02/22/2020 1:22:43 PM PST by nuconvert ( Warning: Accused of being a radical militarist. Approach with caution.)
[ Post Reply | Private Reply | To 213 | View Replies]

To: mrsmith

The Trump admin had better get on top of this crap too:

https://twitter.com/Jkylebass/status/1231223519087878144


217 posted on 02/22/2020 1:23:19 PM PST by 9YearLurker
[ Post Reply | Private Reply | To 201 | View Replies]

To: LilFarmer

lesson learned here is, test your airport and cruise ship office staff every other day, given their jobs.


218 posted on 02/22/2020 1:27:11 PM PST by blueplum ( ("...this moment is your moment: it belongs to you... " President Donald J. Trump, Jan 20, 2017))
[ Post Reply | Private Reply | To 212 | View Replies]

To: 9YearLurker

Iran. Video at link

Bruce Porter, Jr.
@NetworksManager
University student at Ferdos dormitory in Iran has been hospitalized and tested positive for #coronavirus. #Covid19 #SARSCoV19

https://twitter.com/NetworksManager/status/1231328353942167555


219 posted on 02/22/2020 1:27:17 PM PST by LilFarmer
[ Post Reply | Private Reply | To 217 | View Replies]

To: SE Mom

Foreign Minister Zarif is being tested. He just finished up meetings in Munich and went to Canada last week & met with Trudeau.
It’s possible they’re testing important people whether they’re showing signs or not.


220 posted on 02/22/2020 1:27:52 PM PST by nuconvert ( Warning: Accused of being a radical militarist. Approach with caution.)
[ Post Reply | Private Reply | To 213 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 181-200201-220221-240 ... 741-750 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson