Posted on 02/22/2020 7:03:34 AM PST by Vermont Lt
China's Gansu Province and Liaoning Province have downgraded their public health emergency response from the highest level to level three, according to local government. The adjustment for these 2 low-risk areas makes sure production and transportation return normal.
YAY! Those lucky Chinese who have a communist government that won't risk their lives for profit- like capitalists would...
So the uncollected bodies are still there since the 49 crematoriums running 24/7 could not keep up and the ccp just brought in incinerators to use for other purposes - makes sense, since there is no problem with internal political security. Likely the only bodies being cremated are the usual 50 or so a day, and the uncollected bodies are the many under 40 people
yep just the ordinary seasonal flu - move along
your guys must be a different bunch from mine
not ready to buy the bioweapon theory
trigger warning: do not read the linked article if you’re an anti-vaxxer and don’t flame me, I’m only pointing to data, not the article:
that said - scroll all the way down past the article and most comments to the Feb 7 post by Extended Vacation, to get to his sequencing comparison between Wuhan, Bat and Sars. In short: SARS: YLNTY Virus: LFQNY Bat isolate: LLYDH
Why he feels this is a nature-derived virus:
“There is an alignment with pShutttle-SN for both the circulating virus and the bat faeces virus but it is almost entirely within the S spike region. Furthermore, the S spike in pShuttle-SN is truncated and there is a SARS S spike which is a much better match for both. So the vast majority of the pShuttle-SN match is explained by a natural common ancestor with the SARS S spike. There is a very small section which matches prior to the S spike (somewhere around 21517). I did another search for this AGAGTTGTTATTTCTAGTGATGTTCTTGTTAACA and I think its part of Replicase 1B another natural match.
I then took a look at the receptor binding domain which according to the paper Isolation and characterization of a bat SARS-like coronavirus that uses the ACE2 receptor has five key amino acids residues involved in interacting with human ACE2 molecule. I guessed that if you wanted to engineer the virus to be more SARS like youd want to change these to be identical to the ones in SARS. The SARS five are YLNTY. The circulating virus has LFQNY and the bat isolate has LLYDH. Im not sure if the framing is right in my analysis here but nothing looks suspicious to me.
I also googled CTCCTCGGCGGG which is a small insert difference and found a short article by Bill Gallaher which indicates this doesnt look engineered either.
In my earlier posts I had misremembered the meta-data of the bat isolate. Its the same one collected in 2013 that other people are reporting, not from 2014 as I wrote previously.
Notes are below if you want to check them. You will need to copy and paste into a monospace font to get the VVVs to point to the five key amino acids.”
https://respectfulinsolence.com/2020/01/31/2019-ncov-wuhan-outbreakdue-to-failed-coronavirus-vaccine/
Iran
Tehran City Council In Limbo After District Mayor Diagnosed With Coronavirus
February 22, 2020
Radio Farda
The meetings of Tehran City Council may be cancelled after the mayor of one Tehran’s 22 districts was diagnosed with coronavirus on Saturday.
The Mayor of District 13 of Tehran, Mojtaba Rahmanzadeh, already had meetings with several officials, including the Chairman of the Council Mohsen Hashemi, in the past few days before testing positive for the virus.
In a tweet on Saturday Hashemi said he was staying home and was going to go to hospital to be tested although he does not have any symptoms of coronavirus infection. Other members of the Council will also be tested for the virus, he said in his tweet.
https://en.radiofarda.com/a/30448789.html
a) the dense-pack of dosing
b) the metal adjuvants
Iran - 5th death
These decisions come a few hours after the authorities announced a fifth death from the new coronavirus, as well as 10 new cases, bringing the total number of infected people in the Islamic Republic to 28.
“We have ten new confirmed cases of Covid-19,” health ministry spokesman Kianouche Jahanpour said on state television on Saturday.
“One of the 10 infected people unfortunately died,” he added.
Mr. Jahanpour did not specify the nationality of the five deceased people.
“Mohsen Hashemi”
He is the son of former President of Iran, Rafsanjani
Local drug store near me was bare bones on cold and flu meds. A couple pack of aspirins and such but stripped bare compared to what I’ve experienced there before.
They did not have what I went there for.
That’s a big deal, he was a VIP.
Hector Torres
@hectorology
Reports that Iranian Brigadier General in the Islamic Revolutionary Guard Corps (IRGC) and commander of the Quds Force infected with #COVID19
no, what I’m saying is, there is more than one reason to bring in incinerators.
Right now, china has bird flu, swine fever, dead livestock from lack of forage deliveries, dead birds, dead pigs, they’re crawling in bats and crows (crows eat carrion and spread disease) rotten vegetables that can’t be transported, two month’s worth of household trash, and all the lovely things a plague brings with it besides just bodies.
And, China is making a huge show right now of nationalism and superiority - of look what we can build and how fast we can build it in spite of a pandemic. And they’ve wanted to build that waste-to-energy plant for 8 months now - the reason for the protests back in July. Overworked crematoriums didn’t stop them from building a popup hospital, right? The Chinese don’t think like we do.
https://mobile.twitter.com/Iran_NewsRoom/status/1223624213426249731
From that same source. I call history revisal on Iran and it’s quarantine. The article I read back then, late , January implied no special handling. The pictures on that link attest to it.
I think Iran is in CYA
That would be Ghaani - he is the replacement for Soleimani
The Trump admin had better get on top of this crap too:
https://twitter.com/Jkylebass/status/1231223519087878144
lesson learned here is, test your airport and cruise ship office staff every other day, given their jobs.
Iran. Video at link
Bruce Porter, Jr.
@NetworksManager
University student at Ferdos dormitory in Iran has been hospitalized and tested positive for #coronavirus. #Covid19 #SARSCoV19
https://twitter.com/NetworksManager/status/1231328353942167555
Foreign Minister Zarif is being tested. He just finished up meetings in Munich and went to Canada last week & met with Trudeau.
It’s possible they’re testing important people whether they’re showing signs or not.
Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.