Free Republic
Browse · Search
General/Chat
Topics · Post Article

To: HangnJudge
This is just too weird, I can’t imagine a mechanism for sperm to egg transfer of mitochondria, scratching head...

I remember being taught that the MtDNA had to come from the mother, and her blood, through the umbilical cord, provided the mitochondria. If Dad is contributing this material, how is his mitochondria introduced?

This might be a window into an unexplored region of the Human genome...

33 posted on 11/26/2018 7:58:42 PM PST by Thommas (The snout of the camel is in the tent..)
[ Post Reply | Private Reply | To 5 | View Replies ]


To: Thommas; HangnJudge; SunkenCiv

The tail of the sperm contains mtDNA and if it enter the egg then there might be paternal mtDNA as well.


43 posted on 11/27/2018 1:52:00 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 33 | View Replies ]

To: Thommas; All

Could it be drug-induced mutation of genetic material that is passing more MtDNA to male children and less to the females? ....Could that explain the whole transgender trend over the past decade or so?


46 posted on 11/27/2018 3:44:06 AM PST by octex
[ Post Reply | Private Reply | To 33 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson