Free Republic
Browse · Search
General/Chat
Topics · Post Article

To: Tilted Irish Kilt; SunkenCiv; nuconvert

This is an interesting idea that should be discussed:

Kill All the Mosquitoes?!
New gene-editing technology gives scientists the ability to wipe out the carriers of malaria and the Zika virus. But should they use it?

http://www.smithsonianmag.com/innovation/kill-all-mosquitos-180959069/?no-ist


9 posted on 06/20/2016 1:59:51 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]


To: AdmSmith
there is some speculation that modified mosquitoes may have CAUSED or exacerbated the spread of zika.

http://theantimedia.org/zika-outbreak-epicenter-in-same-area-where-gm-mosquitoes-were-released-in-2015/

15 posted on 06/20/2016 2:13:29 PM PDT by garyb
[ Post Reply | Private Reply | To 9 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson