Skip to comments.
Ebola Surveillance Thread
Free Republic Threads ^
| August 10, 2014
| Legion
Posted on 08/10/2014 12:46:23 AM PDT by Smokin' Joe
click here to read article
Navigation: use the links below to view more comments.
first previous 1-20 ... 641-660, 661-680, 681-700 ... 5,021-5,032 next last
To: Black Agnes
Thats the chart to watch.
Thanks for the link. More accurate than the WHO numbers, but I believe still too low.
661
posted on
08/19/2014 12:24:00 PM PDT
by
PA Engineer
(Liberate America from the Occupation Media.)
To: Black Agnes
To: PA Engineer
Who knows how many depopulated villages there are in the hinterlands at this point.
To: Black Agnes
To: Black Agnes
Also on Monday, Mercy Ships, which operates the Africa Mercy hospital ship, announced that the Africa Mercy was due to sail for the port of Cotonou, Benin, for its 10-month field service last week, but has delayed its departure pending further assessment due to the virulence of the outbreak in neighboring Nigeria.
Nigeria is not being banned from the Haj. That would provide a very rapid vector to the rest of the world.
665
posted on
08/19/2014 12:30:44 PM PDT
by
PA Engineer
(Liberate America from the Occupation Media.)
To: PA Engineer
Not being banned from the Hajj YET IMHO.
To: Smokin' Joe
667
posted on
08/19/2014 1:06:09 PM PDT
by
Smokin' Joe
(How often God must weep at humans' folly. Stand fast. God knows what He is doing.)
To: Lady Heron
1. the Ebola epidemic will be self contained in the region, but many more will be infected. R0 = about 3. It is, as you write, very dangerous in these poor countries, lacking even rubber gloves, but not in the industrialized world.
2. The big danger is a pandemic influenza.
3. The idea about 3000 Ebola suicide warriors is just the bad imagination from this crazy site http://www.thetotalcollapse.com/3000-ebola-martyrs-warned-ready-to-strike-america/ You can see other Bravo Sierra texts at their site.
668
posted on
08/19/2014 1:17:26 PM PDT
by
AdmSmith
(GCTGATATGTCTATGATTACTCAT)
To: Black Agnes
To: Black Agnes
To: Smokin' Joe
671
posted on
08/19/2014 1:28:01 PM PDT
by
Smokin' Joe
(How often God must weep at humans' folly. Stand fast. God knows what He is doing.)
To: Smokin' Joe
672
posted on
08/19/2014 1:31:50 PM PDT
by
Smokin' Joe
(How often God must weep at humans' folly. Stand fast. God knows what He is doing.)
To: Black Agnes
To: Black Agnes
To: Black Agnes
To: Black Agnes; Covenantor
To: Smokin' Joe
677
posted on
08/19/2014 5:57:48 PM PDT
by
Smokin' Joe
(How often God must weep at humans' folly. Stand fast. God knows what He is doing.)
To: Smokin' Joe
678
posted on
08/19/2014 6:03:50 PM PDT
by
Smokin' Joe
(How often God must weep at humans' folly. Stand fast. God knows what He is doing.)
To: Black Agnes
To: Black Agnes
Navigation: use the links below to view more comments.
first previous 1-20 ... 641-660, 661-680, 681-700 ... 5,021-5,032 next last
Disclaimer:
Opinions posted on Free Republic are those of the individual
posters and do not necessarily represent the opinion of Free Republic or its
management. All materials posted herein are protected by copyright law and the
exemption for fair use of copyrighted works.
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson