Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

ESCALATION: Russia Begins Tactical Nuclear Weapons Drill Near Ukraine’s Border ‘To Counter Militant Statements by Western Officials’ (VIDEO)
https://www.thegatewaypundit.com/ ^ | 5/22/2023 | paul serran

Posted on 05/22/2024 10:04:16 AM PDT by bitt

The world is getting more and more dangerous by the day.

With NATO, the EU and Russia entangled in an European conflict that keeps escalating, it is very bad news that nuclear weapons are now the talk of the day.

The Russian Federation forces have begun the ‘first stage’ of exercises to simulate preparation for the launch of tactical nuclear weapons.

Ordered by recently reelected President Vladimir Putin, the exercises are reportedly linked to what Moscow calls ‘militant statements’ by Western officials that ‘create security threats for Russia’.

Reuters reported:

“Nuclear analysts say the exercises are designed as a warning signal by Putin to deter the West from wading more deeply into the war in Ukraine. Western countries have provided weapons and intelligence to Kyiv but have refrained from sending troops.”

The Russian Defense Ministry said this first stage of the drill involves Iskander and Kinzhal missiles.

“It is aimed at ensuring that units and equipment are ready for ‘the combat use of non-strategic nuclear weapons to respond and unconditionally ensure the territorial integrity and sovereignty of the Russian state in response to provocative statements and threats of individual Western officials against the Russian Federation’, the ministry said.”

The exercises are led by the Southern Military District, which lies adjacent to Ukraine and newly annexed territories.

The situation has escalated so much that Reuters feels it has to try and guess the results of such an attack – which unfortunately is not unthinkable anymore.

“In theory the use of such a weapon could deliver a stunning shock to the West without necessarily triggering a full-blown nuclear war, though the risk of triggering a cycle of escalation would be huge.”

Russia is reported to have about 1,558 non-strategic nuclear warheads.

Watch: Video released by the ministry showed missiles being transported in a convoy of military vehicles and placed in position ready for firing.

more..


TOPICS:
KEYWORDS: cubarussia; drill; nuclearweapons; putinsfolly; russia
Navigation: use the links below to view more comments.
first previous 1-20 ... 61-8081-100101-120121-132 next last
To: bimboeruption

“Not a drop of Russian, or Slavic blood, for that matter, in my body.”

- posted on 5/13/2024, 4:06:22 PM by bimboeruption

Prove it. Show us the results of a DNA test and then show us your genealogy as well.


81 posted on 05/24/2024 10:13:11 AM PDT by MeganC (Ruzzians aren't people. )
[ Post Reply | Private Reply | To 80 | View Replies]

To: ANKE69

Meggie’s a mightier hunter than Davy Crockett. We used to sing his ballad when we were kids. I wonder if they sing it in Ukraine?

Here’s the first verse:

Born on a mountain top in Tennessee,
Greenest state in the land of the free.
Raised in the woods so’s he knew every tree,
Killed him a bear when he was only three.
Davy, Davy Crockett King of the Wild Frontier.

source: https://www.lyricsondemand.com/tvthemes/davycrockettlyrics.html

Sounds like meggie, doesn’t it?


82 posted on 05/24/2024 10:18:19 AM PDT by bimboeruption (“Less propaganda would be appreciated.” JimRob 12-2-2023)
[ Post Reply | Private Reply | To 75 | View Replies]

To: MeganC

Prove hubby killed ruzzzzzzzzzzians.


83 posted on 05/24/2024 10:19:06 AM PDT by Darksheare (Those who support liberal "Republicans" summarily support every action by same. )
[ Post Reply | Private Reply | To 81 | View Replies]

To: bimboeruption

Sure does! 🐻🐼


84 posted on 05/24/2024 10:31:32 AM PDT by ANKE69 ("Russians aren't people" proudly posted by MeganC)
[ Post Reply | Private Reply | To 82 | View Replies]

To: mass55th; Rocco DiPippo

One example:

At night between 7 and 8 February, US forces carried out airstrikes on columns of pro-Assad troops, including a group of Russian soldiers from the so-called private military company Wagner Group, near Deir ez-Zor. This was their response to Russian attempts to seize control of a local base of the Syrian Democratic Forces (an armed Syrian opposition group, mainly consisting of Kurds, backed by the USA) and probably to take possession of a local oil and gas production field. It is believed that dozens of Russians were killed at the spot during the US airstrikes (although it is impossible to determine the precise death toll), which makes it the most serious Russian-US incident of this type since the 1970s.

https://www.osw.waw.pl/en/publikacje/analyses/2018-02-21/russian-losses-near-deir-ez-zor-a-problem-kremlin


85 posted on 05/24/2024 10:46:03 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 55 | View Replies]

To: AdmSmith
NATO's Braintrust


86 posted on 05/24/2024 10:50:37 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 85 | View Replies]

To: bimboeruption; ANKE69; All

So the C in MeganC stands for Crockett?


87 posted on 05/24/2024 10:52:46 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 82 | View Replies]

To: AdmSmith; MeganC; Rocco DiPippo; Allegra; Worldtraveler once upon a time; kiryandil; ...

Thanks for the link. It’s nice that you tried to come to Meggie’s rescue, but MeganC made the bold statement that her “husband fought and killed Russians,” so I’d prefer hearing from her fingertips, her explanation for saying that, and also for her to expound on it. You don’t brag about $hit like that on a public forum, and then suddenly go deaf and dumb when someone asks you to explain.


88 posted on 05/24/2024 10:58:00 AM PDT by mass55th (“Courage is being scared to death, but saddling up anyway.” ― John Wayne)
[ Post Reply | Private Reply | To 85 | View Replies]

To: AdmSmith

I’d previously listed several such incidents for Rocco and he simply ignores these things. They contradict his narrative and the narrative is what matters to him.


89 posted on 05/24/2024 10:59:05 AM PDT by MeganC (Ruzzians aren't people. )
[ Post Reply | Private Reply | To 85 | View Replies]

To: mass55th; AdmSmith

My mistake was mentioning that.

Since I did you monkeys have used it over and over in an effort to torment me, intimidate me, silence me, or just for pure sadism as is the case with one of your cohort.

There is not even a chance in Hell that I’d give you bastards any more information than that because you’ll absolutely use it against me.


90 posted on 05/24/2024 11:08:27 AM PDT by MeganC (Ruzzians aren't people. )
[ Post Reply | Private Reply | To 88 | View Replies]

To: bimboeruption
"I know what your response to me is going to be: "Name calling is against FReeper rules" but a few days ago, you called us "pricks" and none of us ran to the mods. Your post is still there serving as a reminder to FReepers as to what a foul mouthed hypocrite you are."

Two days ago she wrote that we were "obsessed with sexual perversions." Like her mentor UMCRevMom, she took my use of TV (television) in my comment, and twisted it like the obsessive maniac she is, and claimed it stood for Trannies. I never hit the abuse button. She must have to soak her finger every night in order to get it back in working order for the next day.

ESCALATION: Russia Begins Tactical Nuclear Weapons Drill Near Ukraine’s Border ‘To Counter Militant Statements by Western Officials’ (VIDEO)

91 posted on 05/24/2024 11:15:47 AM PDT by mass55th (“Courage is being scared to death, but saddling up anyway.” ― John Wayne)
[ Post Reply | Private Reply | To 74 | View Replies]

To: MeganC
"There is not even a chance in Hell that I’d give you bastards any more information" - MeganCrockett

The Castaways - Liar Liar, Pants on Fire


92 posted on 05/24/2024 11:30:53 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 90 | View Replies]

To: JonPreston

This is better:

https://www.youtube.com/watch?v=VTjLQcY37FQ


93 posted on 05/24/2024 11:34:54 AM PDT by MeganC (Ruzzians aren't people. )
[ Post Reply | Private Reply | To 92 | View Replies]

To: MeganC
Liar, Liar - Dance performance by The Honey Bees (Mary Ann, Ginger and Lovey) of Gilligan's Island


94 posted on 05/24/2024 11:38:46 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 93 | View Replies]

To: MeganC; Rocco DiPippo; Allegra; Worldtraveler once upon a time; kiryandil; aMorePerfectUnion; ...
"My mistake was mentioning that"

You've been here 15 years. You should know better than to bait anybody on this site by saying "My husband fought the Russians and he killed some of them too.", and not expect to be questioned about it. You can claim naivety about saying it, but that isn't what happened. You said it in a braggadocio manner, and when asked about it, went deaf and dumb. And now all you can do is cry victim claiming people, or as you like to call them, "monkeys" are tormenting you, simply because they want to know what you meant by that comment. You must have expected it, so I'm of the belief that you like the attention you're getting over it.

By the way, you must have a special place in your heart for monkeys since you like to call people that too. Must be a term of endearment, so thanks.

95 posted on 05/24/2024 11:45:55 AM PDT by mass55th (“Courage is being scared to death, but saddling up anyway.” ― John Wayne)
[ Post Reply | Private Reply | To 90 | View Replies]

To: mass55th; MeganC

Megan, just own the lie you told about your husband killing Ruzzian solders.


96 posted on 05/24/2024 1:12:45 PM PDT by tennmountainman ( (“Less propaganda would be appreciated.” JimRob 12-2-2023 DITTO)
[ Post Reply | Private Reply | To 95 | View Replies]

To: Rocco DiPippo

YouCraynee Clown Award.
It was a unanimous vote.
Congrats to MeganC.


97 posted on 05/24/2024 1:25:48 PM PDT by tennmountainman ( (“Less propaganda would be appreciated.” JimRob 12-2-2023 DITTO)
[ Post Reply | Private Reply | To 48 | View Replies]

To: ANKE69
Noooo! Bwahahahaha! Where's the link to that awesome Meg Mitty bear slaying "adventure?"

I'm surprised she hasn't yet said, "I fought Ruzzians and killed some too." Bet that one's coming up shortly.

98 posted on 05/24/2024 1:39:05 PM PDT by Rocco DiPippo (Either the Deep State destroys America or we destroy the Deep State. -Donald Trump)
[ Post Reply | Private Reply | To 75 | View Replies]

To: tennmountainman

Fine, call it a lie if it’ll make you happy.

Now stop bothering me.


99 posted on 05/24/2024 1:47:02 PM PDT by MeganC (Ruzzians aren't people. )
[ Post Reply | Private Reply | To 96 | View Replies]

To: MeganC; AdmSmith; bimboeruption; Allegra; ransomnote; Worldtraveler once upon a time; Vlad0; ...
"I’d previously listed several such incidents for Rocco and he simply ignores these things. They contradict his narrative and the narrative is what matters to him."

Oh no, Meggie - you're not going to deflect and distract from the fantastic tale you told and the fact that you went silent, then belligerent, then psycho when asked to clarify and confirm it.

Here's what you said: "My husband fought the Russians and he killed some of them too."

https://freerepublic.com/focus/chat/4237446/posts?page=27#27"

Then, I and others asked some questions about that statement. Here are some of the ones I asked you:

"Did your husband fight Russians and kill some too as you have stated? If so, how did he confirm that the men he supposedly fought and killed actually were Russian?

Did he fight and kill them on the ground, or in the air, as you've implied he did by furiously posting articles implying that?

If he did fight and kill them in the air, how did he confirm that the pilots he fought and killed were Russians? Did he swoop down after combat and land next to the wreckage of his vanquished enemy, then hop out, drag the body of the dead pilot out of the wreckage and confirm he was Russian?. . ."

And more questions from me in the same vein: "Now, is that statement in which you say your husband fought and killed Russians true? If so, how did your husband confirm that the men he fought and killed were Russians? Furthermore, given your longstanding, snuff-fantasy, sick reactions to Russians being maimed and killed, (and wishing death on some Freepers), how were you able to keep your husband's RuZZian fighting and killing a secret from us for so long? If your statement was true, you'd have been dropping it on these threads and reveling in it like a mangy street dog rolling in feces for years at this point."

"So, now you're doubling down on your laughable, snuff-fantasy statement that, "My husband fought the Russians and he killed some of them too." Then you post links about Russian pilots flying against the US in Korea and in 'Nam, implying that your husband was a fighter pilot who engaged in combat with Russian pilots.

So, how did your husband confirm that some, or all, of his kills were Russians? Did he land his P-51 next to the wreckage of the planes he shot down in 'Nam and/or Korea and examine the dead pilot's corpse, then rip the Russian flag off the dead pilot's charred flying suit and then hop back into his Mustang and fly back to his base with it, arriving to a glorious welcome home with his fellow pilots who joyfully screamed, "SLAVO U CRAYKNEE!!!" when he climbed out of his battered, bullet-ridden P-47 Thunderbolt?"

Meggie's furious "response" was to begin digging up information about me from the internet and posting it in the thread to try intimidating me. Her next move was to throw a series of personal insults at me. So in response to her abusive crap my comments to her became more sarcastic as things progressed.

Fact: Not once did she answer any of my questions about her "Russian killing" assertion nor has she responded to any questions from the many other Freepers who questioned her tale.

So it's clear at this point that Meggie made the whole thing up and has since been trying to save face by lying, maligning people, gaslighting and attempting every pathetic, diversionary tactic she knows. Ugh.

Sorry Meggie, your embarassing jig's up and everyone on FR knows it - except for you.

Now, let's move on to your tale about the bear you killed! That sounds like another howler!

100 posted on 05/24/2024 2:18:42 PM PDT by Rocco DiPippo (Either the Deep State destroys America or we destroy the Deep State. -Donald Trump)
[ Post Reply | Private Reply | To 89 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 61-8081-100101-120121-132 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson