Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 9,541-9,5609,561-9,5809,581-9,600 ... 19,041-19,052 next last
To: BeauBo

Another industry suffering from Putin’s disastrous “leadership”.

“Russian President Vladimir Putin has called for urgent measures to support the country’s coal companies, which face multibillion-dollar losses and risk mass bankruptcies, The Moscow Times reported on Dec. 12.

Russia’s coal industry has been severely impacted by the loss of Western markets and declining demand in “friendly” nations. Coal companies reported a combined loss of 91 billion rubles ($873 million) in the first nine months of 2024.”


9,561 posted on 12/13/2024 7:31:19 PM PST by BeauBo
[ Post Reply | Private Reply | To 9560 | View Replies]

To: gleeaikin

The Russian system is all about financial fiefdoms granted to the oligarchs. Maybe one of them had a piece of this drug operation.


9,562 posted on 12/13/2024 7:42:33 PM PST by buwaya (Strategic imperatives )
[ Post Reply | Private Reply | To 9558 | View Replies]

To: BeauBo

It’s not likely their main threat is something an S400 can take down. The “rebel” guys are within mortar range.


9,563 posted on 12/13/2024 7:44:23 PM PST by buwaya (Strategic imperatives )
[ Post Reply | Private Reply | To 9559 | View Replies]

To: gleeaikin

Russian Offensive Campaign Assessment, December 12, 2024

People’s Republic of China (PRC) President Xi Jinping continues to provide Kremlin officials with a platform from which to articulate their uncompromising demands on Ukrainian sovereignty. Russian Security Council Deputy Chairperson Dmitry Medvedev met with Xi in Beijing on December 12.[14] Xi and Medvedev discussed the situations in Syria and Ukraine and highlighted the bilateral Russia-PRC relationship and their cooperation in multilateral institutions. Xi reiterated the PRC’s standard stance on the war in Ukraine, calling for “de-escalation” and advertising the PRC’s “Friends of Peace” Initiative with Brazil.[15] Medvedev later told Russian media on December 12 that he and Xi discussed potential settlements in Ukraine and claimed that Russia is “ready to resume negotiations with Ukraine” but only if “Ukraine understands the realities that have developed ... on the ground.”[16] Medvedev explicitly invoked Russian President Vladimir Putin’s June 14, 2024 speech at the Russian Ministry of Foreign Affairs (MFA), wherein Putin stated that Ukrainian forces must “completely withdraw” from Ukrainian-controlled territory in Donetsk, Luhansk, Zaporizhia, and Kherson oblasts before Russia would agree to enter into negotiations.[17] Kremlin officials have long used the expression “realities on the ground” to refer to Russian gains on the battlefield, albeit largely incremental and gradual, and to force Ukraine and its partners to make concessions on Ukraine’s sovereignty by recognizing the territories that Russia has illegally occupied and annexed as part of Russia including those that Ukrainian forces still hold.[18] Russia’s version of “negotiations” that take into account the “realities on the ground” call for Ukraine to surrender nearly 20 percent of its territory and millions of its people living under Russian occupation. Xi and the PRC have continually provided Kremlin officials with a platform to advocate for this desired end-state to the war, as ISW has previously reported.[19]

The Russian government continues efforts to evade Western sanctions targeting the import and export of goods used to support Russia’s war effort. Russian investigative outlet The Insider reported on December 11 that Russia continues to import thousands of Western-manufactured sniper rifles and millions of rounds of ammunition through loopholes in Western sanctions targeting Russia.[87] The Insider reported that Russian importers continue to purchase Western small arms through third party countries, such as Armenia, Georgia, Kazakhstan, Kyrgyzstan and Uzbekistan, whose imports of Western firearms have increased exponentially since the start of Russia’s full-scale invasion of Ukraine. The Insider reported that there continue to be some partnerships between Western arms manufactures and Russian arms importers despite Western sanctions banning such activities. Ukraine’s Main Military Intelligence Directorate (GUR) reported on December 12 that Russian authorities are employing a “shadow fleet” of 238 poorly maintained oil tankers under ambiguous ownership that enable the Russian government to circumvent Western sanctions and generate billions of dollars in annual revenue from oil sales.[88] The GUR reported that Russia generated $188 billion in revenue from oil sales using these sanctions evasion methods in 2023 alone.

Russia’s civilian aviation industry continues to suffer due to Western sanctions, even as Russian military imports and oil exports continue to flow freely. BBC Russian Service reported on December 12 that Russia’s United Aircraft Corporation has built only seven out of a planned 108 commercial aircraft since 2022 due to Western-imposed sanctions targeting the export of aviation components to Russia.[89] BBC’s Russian Service reported that Russian authorities responded to Western sanctions in 2022 with an ambitious domestic airline manufacturing program which has since floundered under the pressure of Western sanctions.

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-december-12-2024


9,564 posted on 12/13/2024 11:40:58 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9457 | View Replies]

To: JonPreston
Good morning Thread.

Though for the day:

If there were unidentified drones flying over Ukraine rather than New Jersey, we’d have sent Zelensky $100 billion and 40 tanks already.

9,565 posted on 12/14/2024 5:03:18 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9522 | View Replies]

To: AdmSmith

It is interesting to note that at the beginning of this conflict Russia and the usuals here stated that Russia has all it needed to prosecute this war and was self sufficient….., yet as your post points out Russia is very dependent on outside sources for ammunition and equipment.
I would also add that Russia is far from able to trade oil and other good “freely”

Besides that fact that their exports other than oil have collapsed to near zero, the oil that they are trading is not producing near the revenue that it could, and the more profitable refined products and natural gas exports are very much diminished or non-existent.

Sanction busting and black market trading is not cheap or easy.

Lastly the collapse of Russian influence in Syria is a good indicator of their status.

I guess this is all going according to plan😎


9,566 posted on 12/14/2024 5:09:12 AM PST by blitz128
[ Post Reply | Private Reply | To 9564 | View Replies]

To: AdmSmith
According to reports from Russian Telegram channels, the oil depot in Orel continues burning after last night's drone attack.

https://x.com/Gerashchenko_en/status/1867867211018448960


9,567 posted on 12/14/2024 5:56:46 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9564 | View Replies]

To: blitz128
IT'S OVER, you know.

(Of course there may be some confusion as to what "it" is.)

9,568 posted on 12/14/2024 6:00:01 AM PST by Mr. Lucky
[ Post Reply | Private Reply | To 9566 | View Replies]

To: BeauBo
Partisans!

On December 14, 2024, in the city of Krymsk, Krasnodar Territory, Russia, saboteurs burned an enemy Su-30 fighter jet right at the airfield.

Video by the Main Directorate of Intelligence of the Ministry of Defence of Ukraine.

https://x.com/bayraktar_1love/status/1867887369892049162

Krasnodar on Google Maps


9,569 posted on 12/14/2024 6:04:20 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9567 | View Replies]

To: PIF
The 1st Marine Battalion of the 36th Marine Brigade destroyed a Russian armored carrier with FGM-148 Javelin ATGM.

https://x.com/NOELreports/status/1867903348667826238


9,570 posted on 12/14/2024 6:13:00 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9569 | View Replies]

To: Mr. Lucky

True


9,571 posted on 12/14/2024 6:16:39 AM PST by blitz128
[ Post Reply | Private Reply | To 9568 | View Replies]

To: FtrPilot

Russian Forces Appear To Be Pulling Out Of Prized Syrian Air Base
Satellite imagery and drone footage show the packing up of the base’s S-400 air defense system and major airlifter activity.
https://www.twz.com/air/russian-forces-appear-to-be-pulling-out-of-prized-syrian-air-base


Cockpit Video Of Ukrainian Su-27 Lobbing GBU-39 Small Diameter Bombs
The Flanker popped up from low altitude to launch a salvo of the U.S.-supplied precision-guided glide munitions against a Russian target.
https://www.twz.com/air/cockpit-video-of-ukrainian-su-27-lobbing-gbu-39-small-diameter-bombs


None Of The New Jersey Visual Drone Sightings Have Been Corroborated: White House
The use of “very sophisticated electronic detection technologies” has confirmed none of the visual sightings, and regular aircraft are being mistaken for drones.
https://www.twz.com/air/white-house-says-none-of-the-new-jersey-visual-drone-sightings-have-been-corroborated


Ukraine’s SA-8 Gecko ‘FrankenSAM’ Adapted To Fire Air-To-Air Missiles Seen In New Detail
All Ukrainian units operating Soviet-era Osa air defense systems have reportedly received upgraded versions armed with R-73 air-to-air missiles.
https://www.twz.com/land/ukraines-sa-8-gecko-frankensam-adapted-to-fire-air-to-air-missiles-seen-in-new-detail


Plans For New Hardened Aircraft Shelters Notably Absent From New USAF Base Modernization Strategy
The USAF also says that its bases can no longer be treated as sanctuaries and need to be better prepared to operate while under attack.
https://www.twz.com/air/plans-for-new-hardened-aircraft-shelters-notably-absent-from-new-usaf-base-modernization-strategy


9,572 posted on 12/14/2024 6:25:05 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9570 | View Replies]

To: FtrPilot

That can’t be a good look. Someone(s) are getting sent to the western front


9,573 posted on 12/14/2024 6:25:16 AM PST by blitz128
[ Post Reply | Private Reply | To 9569 | View Replies]

To: blitz128
"Someone(s) are getting sent to the western front"

Here's the perfect place for them...

Reports are coming in of Russian forces conducting meat-grinder assaults in columns, with no armored transport support, near the village of Kruglenkoye on the Kursk bridgehead.

Despite heavy losses, they continue to advance, desperately trying to carry out Putin's orders.

https://x.com/wartranslated/status/1867906581817647394


9,574 posted on 12/14/2024 6:28:12 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9573 | View Replies]

To: PIF
Here’s another comment from a Ukrainian soldier about the Koreans – it’s reported that they went into battle a week ago.

This suggests that the Russian claims regarding the involvement of Koreans in the fighting for Plekhov might indeed be true.

https://x.com/wartranslated/status/1867892415107129395


9,575 posted on 12/14/2024 6:33:56 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9574 | View Replies]

To: FtrPilot

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Ukrainian Forces Destroy Russian Gains in Fierce Counter Attacks ]


Today [ Dec 13, 8 pm ], there is a lot of news from the Pokrovsk [ Avdiivka ] direction.

Here, Russian forces have recently increased their offensive efforts south of Pokrovsk, as Russians attempt a spearhead through Ukrainian lines, leading to a significant spike in casualties, as Russians quickly burnt through all their reserves.

This sudden and increased exhaustion amongst Russian forces, created a window of opportunity that Ukrainians exploited to conduct devastating counterattacks, putting immense pressure on the Russian offensive effort as a whole.

The ultimate Russian goal in the region is to gain control over Pokrovsk’s surrounding fields and infrastructure, and to take fire control over key Ukrainian logistics routes. To achieve this, they aim to advance parallel to the local rivers and railways running toward Pokrovsk, leveraging geographical features, such as ravines, marshlands, and forest belts to mask their movements and facilitate infiltration.

Such terrain features are especially useful in the wintertime, when the day is shorter and there is a lot of fog and rain that can hinder the work of Ukrainian drones. This also allows the Russians to work more under the cover of nighttime.

This strategy, observed in other contested areas, is designed to isolate and exhaust Ukrainian defenders, as the Russians launch small infantry groups, often numbering 20-30 soldiers, deployed in waves every 30-40 minutes to probe for gaps in Ukrainian defenses.

These attacks are supplemented by attempts to flank Ukrainian positions at night, with soldiers crossing fields individually or in pairs, before regrouping for larger assaults.

Despite the relentless Russian offensives, Ukrainian forces have effectively exploited several Russian vulnerabilities. The fragmented nature of Russian assaults, combined with their reliance on pure infantry tactics, leaves attackers vulnerable to well-coordinated defensive measures.

Ukrainian defenders have leveraged their knowledge of the terrain to establish layered defenses, channeling Russian advances into kill zones where concentrated firepower, utilizing artillery and drones, can be deployed with devastating effect.

Ukrainians have also capitalized on the exhaustion and disorganization inherent in the Russian strategy. By targeting exposed soldiers during their movement across open terrain or ravines, and by using drones to disrupt and demoralize enemy units, the defenders have inflicted heavy casualties.

Reports indicate daily Russian losses in the area reach 50-70 killed and an equal number of wounded in this area alone. Such attrition significantly undermines the momentum of the Russian advance.

Crucially, Ukrainian forces have not remained passive. Instead, they have conducted local counterattacks to exploit windows of opportunity created by overextended Russian units.

For example, Ukrainian tank units, including T-72B1S, have been deployed to target enemy positions and disrupt Russian attempts to consolidate gains near Shevchenko. Geolocated footage shows how they target Russian positions in houses and three lines, successfully eliminating the enemy.

Another interesting video from the vicinity of Novotroyitske shows how Ukrainians destroy another Russian infantry group, by targeting it with mortars, then with grenades, and at the end we can see the pivotal role of a Bradley infantry fighting vehicle, which is used to destroy a bridge, to not only hinder Russian mobility, but also to cut the enemy from receiving additional support.

Ukrainian drones, including FPV kamikaze models and Vampire hexacopters, have been instrumental in these counterattacks. Their ability to strike precise targets, including Russian vehicles and infantry, has turned the tide in several engagements.

This active defensive posture not only prevents Russian forces from achieving their objectives but also imposes further costs on the attackers, pumping up their already significant losses.

Overall, while the Russian push continues, the heavy toll on their personnel and equipment raises questions about the sustainability of their offensive.

Smaller Russian assault groups of 10 soldiers, a tactical adaptation to high losses, have been largely ineffective against Ukraine’s proactive defense, marked by adaptive tactics and localized counterattacks, which have steadily undermined Russian advances and diminished their chances of encircling Pokrovsk.

Their efforts underscore the importance of morale and leadership, highlighted by President Zelensky’s recent visit to the region.

By personally thanking the defenders and reviewing the construction of new defensive lines, Zelensky reinforced the resolve of Ukrainian forces to hold the line against overwhelming odds. This visit symbolizes both the strategic and symbolic significance of Pokrovsk in the ongoing war.


9,576 posted on 12/14/2024 6:39:50 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9570 | View Replies]

To: JonPreston

Congratulations to Mikheil Kavelashvili on becoming Georgia’s new president.

A true patriot who is going to put his country’s interests first and won’t allow NATO and the EU to ruin Georgia’s future like they did with Ukraine. pic.twitter.com/rTpHyQGpX7— Gabe (@GabeZZOZZ) December 14, 2024


9,577 posted on 12/14/2024 6:40:03 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9565 | View Replies]

To: BeauBo
President Zelensky highlighted the work of Ukraine's air defenders in countering Russia's overnight drone attacks, involving over 130 UAVs.

Around 60 were shot down, and over 70 were lost or failed to reach targets.

He thanked air defense units, aviation, electronic warfare teams, and mobile fire groups for protecting civilians and infrastructure but emphasized the need for more support.

https://x.com/NOELreports/status/1867911036923232759


9,578 posted on 12/14/2024 6:43:06 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9575 | View Replies]

To: BeauBo

Russia GDP Annual Growth Rate

Russia’s GDP expanded by 3.1% from the corresponding period of the previous year in the third quarter of 2024. The figure was above the Ministry of Finance's estimate of a 2.9% expansion, and slightly below the central bank's forecast of a 3.2% growth. The GDP contracted for mining (-1.1%) and agriculture, forestry, hunting (-5.2%), offset by output growth for manufacturing (5.9%). source: Federal State Statistics Service

The Gross Domestic Product (GDP) in Russia expanded 3.10 percent in the third quarter of 2024 over the same quarter of the previous year. GDP Annual Growth Rate in Russia averaged 2.68 percent from 1996 until 2024, reaching an all time high of 12.10 percent in the fourth quarter of 1999 and a record low of -11.20 percent in the second quarter of 2009. This page provides the latest reported value for - Russia GDP Annual Growth Rate - plus previous releases, historical high and low, short-term forecast and long-term prediction, economic calendar, survey consensus and news. Russia GDP Annual Growth Rate - data, historical chart, forecasts and calendar of releases - was last updated on December of 2024.

The Gross Domestic Product (GDP) in Russia expanded 3.10 percent in the third quarter of 2024 over the same quarter of the previous year. GDP Annual Growth Rate in Russia is expected to be 3.50 percent by the end of this quarter, according to Trading Economics global macro models and analysts expectations.


9,579 posted on 12/14/2024 6:52:52 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9561 | View Replies]

To: FtrPilot

Kremlin snuff box, 12/13/24
https://t.me/s/kremlin_secrets

The deep language of individual majors... Or what is important to know about the removal of General Ovcharov

A curious and at the same time disgusting story is happening around the removal from the post of commander of the 3rd Guards Combined Arms Army, Major General Dmitry Ovcharov. The other day a version appeared [ see below ] that the general was punished because the enemy managed to take possession of the T-90MS Proryv tank.

On our own behalf, we will say that there have been complaints against Ovcharov before. And in general, changes in command are a constant practice that allows us to avoid repeating mistakes. The only thing missing is real punishment for (sorry) crimes.

But we noticed how the Two Majors channel, which constantly receives funds from the Ministry of Defense, literally licked the butt of its new owner [ https://t.me/dva_majors/60115 ]. Naturally, Belousov has already settled into the chair of the Minister of Defense, but you have to be able to please Andrei Removich so deeply and with such smacking! What our military officers and telegram channels in general lack is sobriety of mind. The bosses may change, but should everyone perform oral sex in public?


Children of Arbat, 12/13/24
https://t.me/arbat/1948

The children of Arbat became aware of the details of the removal of the commander of the 3rd Guards Combined Arms Army of Major General Dmitry Ovcharov, who was subordinate to General Andrei Sychev in the Bakhmut group.

According to the version circulating online, Ovcharov was removed from his post for misinforming the higher command about the pace of advance of his troops. In fact, the main reason for the inspection and subsequent removal was the T-90MS Proryv tank captured by the enemy, abandoned by the crew due to a downed track. In Moscow, they were very surprised by the enemy personnel, since the tank was captured deep in the rear of our troops.

The inspection, organized at the direction of Andrei Belousov, led by the heads of the Main Military-Political and Main Military-Investigative Directorates, affected everyone in the Southern Military District, including the commander, General Anashkin, who promptly left for the post of head of the Frunze Academy.

At the same time, the figure of one of the “heroes” of the surrender of Izyum and Balakleya, General Sychev, who failed to take Chasiv Yar, and also likes to report on progress of 300-500 meters where there were no results, has so far remained unaffected.

Will Sycheva repeat the fate of Ovcharov, whom he sacrificed? Decisive measures in this area and in relation to it have been called for for a long time.


9,580 posted on 12/14/2024 7:23:52 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9578 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 9,541-9,5609,561-9,5809,581-9,600 ... 19,041-19,052 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson