Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deathcult; delusionalzeepers; demyanganul; dimwit; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 9,281-9,3009,301-9,3209,321-9,340 ... 19,021-19,027 next last
To: BeauBo
A reconnaissance unit of the 12th Azov Brigade clearing houses on the outskirts of Niu-York. A large group of Russian fighters was destroyed during this battle. Nelipivka, Toretsk sector.

https://x.com/Bodbe6/status/1865846741649727820

7:51 video at the link above.


9,301 posted on 12/08/2024 2:18:37 PM PST by FtrPilot
[ Post Reply | Private Reply | To 9300 | View Replies]

To: FtrPilot

“pipelines could be laid through Syria and Turkey to the EU, which would forever deprive Putin of the ability to blackmail Europe and diversify energy supplies.”

Ditto for the deposits offshore of Crimea - financially weakening Russia, and strengthening its competitors.

Putin did that. Gambled and lost. Recklessly.

If he doesn’t make a deal soon, there will be little left to salvage for Gazprom.

Vladimir, the Doom of Russia.


9,302 posted on 12/08/2024 2:27:23 PM PST by BeauBo
[ Post Reply | Private Reply | To 9298 | View Replies]

To: PIF
⚡️🇺🇦 Ukrainian soldiers from the 66th Separate Mechanized Brigade strike a 🇷🇺 Russian tank and infantry using the Stugna-P ATGM

https://x.com/front_ukrainian/status/1865834443023257706


9,303 posted on 12/08/2024 2:27:33 PM PST by FtrPilot
[ Post Reply | Private Reply | To 9301 | View Replies]

To: FtrPilot

“In exchange for Russia’s help, to prop up those scourge regimes across Africa, Wagner received direct control of lucrative deals for mining operations, especially gold and blood diamonds... this has always been Wagner number one revenue.”

Wagner has alway’s been just a front for Russian Military Intelligence, and putin’s mafia cronies put in charge of it, to siphon off the graft.


9,304 posted on 12/08/2024 2:31:45 PM PST by BeauBo
[ Post Reply | Private Reply | To 9297 | View Replies]

To: FtrPilot; AdmSmith; PIF

Q: What is the difference between a ruble and a dollar?

A: About one dollar.

Russian chipmaker Angstrem has gone into bankruptcy.


9,305 posted on 12/08/2024 7:37:29 PM PST by BeauBo
[ Post Reply | Private Reply | To 9298 | View Replies]

To: BeauBo

Angstrem - Russia’s largest chip maker. Doors closed. Bankrupt.

No need to plan, all is going according to panic…


9,306 posted on 12/08/2024 9:39:50 PM PST by BeauBo
[ Post Reply | Private Reply | To 9305 | View Replies]

Russian Offensive Campaign Assessment, December 8, 2024

The loss of Russian bases in Syria will have major implications for Russia's global military footprint and ability to operate in Africa. Russia has leveraged its Tartus naval base to project power in the Mediterranean Sea, threaten NATO's southern flank, and link its Black Sea assets to the Mediterranean Sea.[19] The loss of Russian bases in Syria will likely disrupt Russian logistics, resupply efforts, and Africa Corps rotations, particularly weakening Russia's operations and power projection in Libya and sub-Saharan Africa. Russia could seek to leverage its presence in Libya or Sudan as alternatives, but the lack of formal agreements with these countries and insufficient infrastructure makes them inadequate substitutes. The collapse of Assad's regime and Russia's inability to preserve the regime will also damage Russia's global image as a reliable ally, threatening its influence with African autocrats whom Russia seeks to support and its broader geopolitical objective to posture as a global superpower.

Russian ultranationalist milbloggers – many of whom fought in or covered the Syrian war – are upset about the fall of the Assad regime, criticizing it as yet another failure of Russian foreign policy to exert and maintain influence in areas of strategic importance. The Russian ultranationalist community broadly criticized the Assad regime for becoming complacent in recent years by allowing its military to degrade and rely on other countries, including Russia and Iran, to provide the Assad regime with defensive capabilities.[20] The milbloggers largely focused on the impact the regime's collapse has on Russia, however, with some describing the fall of the Assad regime as a significant Russian foreign policy failure as Russia did not consistently work to increase Russian influence in the region or push the Assad regime to conduct governmental reforms under the Kremlin's direction.[21] Some milbloggers criticized the Kremlin for not realizing that Assad's military was degraded and that the opposition groups in Syria would likely someday renew offensive operations to exploit Russia's “mistakes” in Syria, with one milblogger noting that Assad's two major allies, Russia and Iran, are currently focusing on the wars in Ukraine and Israel and Lebanon, respectively.[22] One milblogger claimed that many Russian independent analysts and military correspondents had been warning about this possible course of action for years and reiterated longstanding ultranationalist complaints about the lack of a meaningful civil society in Russia to help avoid significant foreign policy failures.[23] A Kremlin-affiliated milblogger bemoaned the impact on Russia's global image, claiming that Russia's reputation is now entirely dependent on the outcome of its war in Ukraine, which is “more important [to Russia] than anything now.”[24]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-december-8-2024

9,307 posted on 12/09/2024 1:32:45 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9232 | View Replies]

Lower intensity due to the weather


9,308 posted on 12/09/2024 2:10:10 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9238 | View Replies]

To: BeauBo

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Ukrainians Hack Russian Radio, Find & Destroy The Base! ]


Today [ Dec 08, 8 pm ], there are a lot of updates from the Kursk direction.

Here, as Russian forces struggle to sustain the pace and intensity of their offensive, they have turned to North Korean heavy equipment to bolster their efforts.

Meanwhile, Ukrainian forces, leveraging intercepted communications, launched successful precision strikes on key Russian bases, dealing a significant blow to the reported deployed North Korean reinforcements and halting the offensive momentum.

The Russian offensive in Nizhny Klin has persisted with high-intensity attacks despite repeated failures to make significant progress. Their primary objective remains to advance along the main highway and secure control of the village. Capturing Nizhny Klin would grant Russian forces a tactically advantageous forested area, providing cover for the buildup of troops and equipment aimed at collapsing the Kursk salient.

Additionally, the village’s elevated position offers a strategic edge, enabling fire control over Ukrainian positions to the east. This would place Ukrainian defenders in Sverdlikovo, situated in a vulnerable low river valley, at a significant tactical disadvantage.

Recognizing the strategic importance of Nizhny Klin, Russian generals have redirected their focus, scaling back offensive efforts elsewhere in the Kursk direction to concentrate their assault units on capturing the village at all costs.

The command appears willing to incur massive losses through relentless “meat-wave” attacks in pursuit of this objective. Ukrainian forces, fully aware of Nizhny Klin’s value and its tactical elevation, heavily mined the fields leading to the village to stall advancing Russian troops.

These fields, located in lowlands, forced Russian forces to traverse exposed terrain, allowing Ukrainian defenders to establish effective fire control over the key Russian attack routes. Moreover, Ukrainians are still the ones who are holding the tactically advantageous positions os Nizhny Klin, making it easier to repel the Russian attacks.

Combat footage from the area shows a sizable Russian mechanized assault formation comprising 6 T-72B3 tanks and BMD-2 armored vehicles carrying airborne stormtroopers. In an effort to shield their troops from Ukrainian artillery and drones, the Russian command relied heavily on these armored vehicles, which ultimately became death traps.

Nearly all vehicles were obliterated by landmines, with secondary explosions from onboard ammunition reducing the wreckage to debris. Ukrainian drone operators then targeted the surviving Russian troops who, in a desperate attempt to retreat, were eliminated while fleeing the carnage.

The worsening shortage of Russian heavy equipment, compounded by mounting losses in the latest wave of attacks, has forced the Russian command to rely on North Korean reinforcements in the Kursk region.

To offset these equipment gaps and bolster assault preparations, North Korea began transporting heavy equipment to the front via rail, including the Koksan self-propelled howitzers intended to provide artillery support for upcoming attacks. Reports suggest that alongside the 50 Koksan howitzers, North Koreans may also deploy tanks to further strengthen Russian operations in the area.

Intercepted radio communications between North Korean officers in the area provided Ukrainian Military Intelligence with critical insights into their operations. The initial exchanges revealed that North Koreans were in a hurry.

Further interceptions gave enough information to identify the training ground where this exchange happened, enabling Ukrainian HIMARS operators to adjust their targeting. As a result, a precision strike was conducted on a North Korean force concentration at the base of the Russian 83rd Airborne Brigade, eliminating a significant force concentration and indefinitely halting their plans.

The presence of North Koreans at a Russian Airborne base aligns with our previous report of Russian efforts to integrate North Korean forces into the VDV structure through the formation of so-called fake Buriat Battalions.

Overall, the reliance on North Korean equipment and personnel highlights the growing desperation of the Russian military to sustain its stalled offensive near Nizhny Klin.

This dependency not only underscores the depletion of Russian resources, but also exposes the logistical and operational vulnerabilities of integrating foreign forces into an already strained system. Ukraine’s precision strikes, informed by real-time intelligence, not only neutralized this new threat, but also demonstrated their ability to preempt and disrupt Russian plans effectively.

These developments significantly weaken Russia’s broader offensive capabilities, leaving its strategy increasingly fragmented and vulnerable to Ukrainian countermeasures.


9,309 posted on 12/09/2024 3:59:52 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9306 | View Replies]

To: AdmSmith

1,220 troops lost, but zero tanks.

The transition from an industrial era army, into a poorly trained mob of lightly armed men, seems to be nearing completion.


9,310 posted on 12/09/2024 4:01:58 AM PST by BeauBo
[ Post Reply | Private Reply | To 9308 | View Replies]

To: BeauBo
the Koksan 170mm self-propelled howitzer
https://en.wikipedia.org/wiki/M-1978_Koksan


9,311 posted on 12/09/2024 4:04:38 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9306 | View Replies]

To: BeauBo

But have you seen Russias GDP numbers….. all is indeed well 😎


9,312 posted on 12/09/2024 5:04:55 AM PST by blitz128
[ Post Reply | Private Reply | To 9306 | View Replies]

To: BeauBo
Here they are:
Phase 1


Phase 2


9,313 posted on 12/09/2024 5:11:10 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9310 | View Replies]

To: All

9,314 posted on 12/09/2024 5:17:06 AM PST by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 9251 | View Replies]

To: BeauBo

Yes, these are pictures of Russian soldiers from WWI.


9,315 posted on 12/09/2024 5:31:34 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9313 | View Replies]




9,316 posted on 12/09/2024 5:37:39 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9190 | View Replies]

To: All
Obama first sent US troops to northeastern Syria in 2014.

US troop numbers in Syria reached a peak of ~2,000 in 2018 under Pres. Trump.

The current level is around 900.

The main purpose of US troops in northeastern Syria is to help protect our Kurdish allies there.

Relatively small numbers of US military are stationed in at least a dozen Middle Eastern countries including Turkey, Syria, Iraq, Kuwait, Bahrain and Djibouti.

9,317 posted on 12/09/2024 5:59:23 AM PST by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 9272 | View Replies]

To: BroJoeK

The main purpose of US troops in northeastern Syria is to help protect our Kurdish allies there.


Their mission is to stop/degrade ISIS from reconstituting, while ensuring the thousands of ISIS prisoners held in Kurdish/Syrian prisons remain there.


9,318 posted on 12/09/2024 6:03:14 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9317 | View Replies]

To: BroJoeK; PIF; BeauBo; blitz128; Magnum44; ansel12; ETCM; marcusmaximus; AdmSmith; gleeaikin
This is amazing!

The Sea Baby drones can fight their way in.

The video at the link below shows that the Sea Baby is controlled real time, most likely via satellite. Also, the AAA gun and gun sight appear to be gyro stabilized.

🔥❗️Special operation "Sea Baby" in the Kerch Bay

On the night of December 5-6, a group of Sea Babu sea drones of the SSU engaged in battle with Russian helicopters, airplanes and Raptor patrol boats that tried to intercept them.

The latest "Sea Baby" were equipped with large-caliber machine guns with ballistic programs for automatic guidance and automatic target acquisition.

Intercepted Russian radio communication indicates that there are dead and wounded on board the helicopters. The helicopters themselves received significant damage and now require major repairs.

SSU drones also hit a barge that was transporting military equipment and equipment for the repair of the Crimean bridge, which the occupiers are still unsuccessfully trying to restore after previous bombings by the Ukrainian special services.

https://x.com/GloOouD/status/1866028028058349902


9,319 posted on 12/09/2024 9:21:35 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9317 | View Replies]

To: PIF
I know you wanna see it again, don't lie.

https://x.com/Bricktop_NAFO/status/1866092745435308422

Toropets on Google Maps


9,320 posted on 12/09/2024 9:43:58 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9319 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 9,281-9,3009,301-9,3209,321-9,340 ... 19,021-19,027 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson