Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 9,141-9,1609,161-9,1809,181-9,200 ... 22,561-22,574 next last
To: PIF
I would like to tell you the story of the failed Russian attack in Kharkiv region.

Three 🇷🇺 infantry fighting vehicles with troops inside were on their way to attack Ukrainian positions.

Two of them exploded on anti-tank mines, and another one passed, but after a while it was hit by a FPV drone, only 4 invaders survived the strike, they landed and almost immediately got struck with drone-dropped munition.

☠️2 - KIA
🤕2 - WIA

https://x.com/GloOouD/status/1865017754132066677


9,161 posted on 12/06/2024 7:18:54 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9157 | View Replies]

To: PIF
🤡😁 An adviser to Iran's foreign minister has appealed to Ukraine to end its support for rebels in Syria, as it undermines its commitment to the fight against terrorism.

What has happened?

https://x.com/PStyle0ne1/status/1864982163365450044

Priceless


9,162 posted on 12/06/2024 7:25:08 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9161 | View Replies]

To: BeauBo
Lavrov: we didn’t attack Ukraine. It is Ukraine and the U.S. who attacked us.

Translation: War is peace. Freedom is slavery. Ignorance is Strength

https://x.com/Mylovanov/status/1864725027850961176


9,163 posted on 12/06/2024 7:32:20 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9162 | View Replies]

To: PIF
🇵🇱 ✈️ 🇺🇦 Sikorski: "We are currently conducting intensive talks with NATO on the transfer of the remaining MiG-29 fighter jets to Ukraine [in exchange for new F-16 modifications]."

https://x.com/Maks_NAFO_FELLA/status/1864643777836495339

Perhaps Poland are trying to get the F-16V (Viper) mod for their F-16s.

9,164 posted on 12/06/2024 7:39:51 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9163 | View Replies]

To: gleeaikin; PIF; blitz128; FtrPilot; BeauBo; USA-FRANCE; canuck_conservative; marcusmaximus; ETCM
Global investigation exposes alleged billion-dollar Russian money-laundering network
Operatives said to be behind a billion-dollar Russian money-laundering network – used by drug dealers, financial criminals and foreign spies – have been sanctioned and arrested in a coordinated international investigation led by the National Crime Agency. The UK law enforcement body, which tackles serious and organised crime, said the actions constituted the “most significant money laundering operation” it had undertaken in the past few years. The operation involved America's Federal Bureau of Investigation, France's Direction Centrale de la Police Judiciaire and Ireland's Garda.

https://www.theguardian.com/business/2024/dec/04/global-investigation-exposes-alleged-billion-dollar-russian-money-laundering-network

Operation Destabilise: NCA disrupts $multi-billion Russian money laundering networks with links to, drugs, ransomware and espionage, resulting in 84 arrests
https://www.nationalcrimeagency.gov.uk/news/operation-destabilise-nca-disrupts-multi-billion-russian-money-laundering-networks-with-links-to-drugs-ransomware-and-espionage-resulting-in-84-arrests

9,165 posted on 12/06/2024 9:26:03 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9164 | View Replies]

Heavens to Murgatroyd, what the actual hell is going on here??

Palestinian refugee harasses a Ukrainian refugee woman in Sweden.

He yells at her:

”I hope he (Putin) kills you”
”You people only talk about Ukraine, not about Palestine’s children”
”F*ck Ukraine” pic.twitter.com/A1wuie7dU7— Visegrád 24 (@visegrad24) December 5, 2024


9,166 posted on 12/06/2024 9:34:41 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9160 | View Replies]

To: PIF
Another aspect of Russian response to the Syrian collapse that everyone might be forgetting about….

Ukraine has destroyed/knocked out multiple Russian transport/landing ships.

Those ships were the Syrian express that transported most of the gear to and from Syria

https://x.com/LostWeapons/status/1864889272329019719


9,167 posted on 12/06/2024 9:44:02 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9163 | View Replies]

To: All
⚡️Russia told Assad that they will be able to help only to a limited extent, as they have other priorities now - Sky News Arabia

https://x.com/front_ukrainian/status/1865062374866063719


9,168 posted on 12/06/2024 9:50:08 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9167 | View Replies]

To: BeauBo
It looks like it's starting: Today, Nabiullina's chief assistant, Denis Vitalyevich Prokhorenko, left Nabiullina's office amid screams and slamming doors.

He was the only one who said that the Central Bank's sky-high lending rate in dollars would "fall back" to 105-110 rubles by the beginning of winter, and wrote that in 2025 the most alarming phase of the conflict would begin.

Two days ago, Denis Vitalievich was fired from the Central Bank - in his channel "Big Economy" he sharply attacked Elvira Nabiullina, describing that 8 out of 10 signs of a deep crisis in Russia have already appeared.

https://x.com/jurgen_nauditt/status/1865048253512978570


9,169 posted on 12/06/2024 9:53:48 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9168 | View Replies]

To: FtrPilot
How can you stand with these kinds of people?

BREAKING: At the USGLC event tonight, Senator Susan Collins (R-ME) says she was so inspired when she traveled to Ukraine with Mitch McConnell and John Cornyn that she wanted to join the front lines - Punchbowl pic.twitter.com/Srk3VKpP9H— Eric Daugherty (@EricLDaugh) December 6, 2024


9,170 posted on 12/06/2024 10:00:54 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9169 | View Replies]

To: JonPreston
The weight of warmongering weighs heavy on one's soul


9,171 posted on 12/06/2024 10:52:13 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9170 | View Replies]

To: FtrPilot

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Ukrainians Cut Russian Ammo & Supplies Then Counterattack! ]


Today [ Dec 05, 8 pm ], there are a lot of developments from the Borova direction.

Here, in a determined push toward Borova, Russian forces relied on overextended and vulnerable supply lines over the Zherebets River.

Recognizing this vulnerability in Russians’ limited river crossings, Ukrainians unleashed a swarm of drones, weakening Russian forces enough for Ukrainian assault brigades to retake the initiative and take control of the battlefield.

Russian forces were trying to capitalize on the foothold they secured by controlling Pershotravneve and Kopanky and push even further. If we take a look at the topographic map, we can see that the main Russian goal here is to take control of the whole hill ridge before advancing on Borova in full force.

However, the main Russian disadvantage is that their supply lines are already overstretched. The Zherebets River flowing through the lowlands, also turns the surrounding areas into extremely muddy terrain, forcing Russians to stick to specific crossings, making their movements predictable for Ukrainian drone operators.

Russians also do not control the main crossing that connects Svatove to Borova along a hardened road, which is why Russians are trying desperately to fully cut off supplies to Ukrainian positions here and fix their own supply issues in the process.

Ukrainian drone operators shared footage showing they were heavily monitoring the area to target Russian soldiers trying to cross the river, showing that many of them did not make it across alive.

To give their infantry a higher chance of making it to the settlements in one piece, Russians tried crossing the river with a mechanized assault, successfully reaching the top of the hills, where the mud is generally much less deep.

Unfortunately for Russians, the 3rd Assault Brigade had already been deployed to the area and quickly responded to the Russian attack. Geolocated footage shows that the Ukrainian 3rd Brigade had swarmed the Russian column with FPV drones, taking out the Russian armored personnel carriers one by one.

The leading Russian tank also attempted to cross through a ditch, but quickly got stuck in the mud, whereafter the crew abandoned the vehicle. The remaining Russian soldiers and armored vehicles quickly lost hope and tried to flee back across the river, but were hunted down by Ukrainian drones and artillery, finishing off the Russian assault group.

The constant Ukrainian drone surveillance severely hampered the Russian ability to sustain their assaults toward Borova. Moreover, Ukrainians did not suffer from the same supply issues that Russians did, as they could transfer food, ammunition, and reinforcements directly from their base of operations in Borova.

With this advantage, and the presence of the well-equipped 3rd Assault Brigade, Ukrainians were able to turn the table on Russian forces and retake the initiative. Recently, the third assault brigade reported that they were in constant battles with the Russians, but were able to fully clear Kopanky of all Russian presence, taking several prisoners of war in the process.

Further reports indicate that Ukrainians have already started their counterattacks on Pershotravneve, but that Russians continue flooding replacement soldiers over the river in a desperate attempt to hold their bridgehead.

Overall, Ukrainians took advantage of their significant logistical advantage and the Russian shortage of supplies to turn the table on Russian forces and retake the initiative.

While Russian channels show the Russian flag hanging on one of the buildings in Pershotravneve, Russian sources also report they had to place the Russian flag in Pershotravneve with a drone, indicating they do not have free movement through the settlements and that Ukrainians heavily monitor the town with snipers and drones.

As Russian control over these settlements weakens, Ukrainians will likely use their advantageous position to continue their localized counteroffensive and push Russians back over the Zherebets River.


9,172 posted on 12/06/2024 11:27:02 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9169 | View Replies]

To: PIF

Romania: How do you know that Russia is extremely upset?

Their main agent, the American communist @jacksonhinklle, has posted 10 times about Călin Georgescu in the past few hours, amplifying Russian propaganda. For me, there’s no longer any doubt: the legionary Călin Georgescu is Russia’s man – beyond any reasonable doubt. And let’s not forget, this Russian agent has nearly 4 million followers on Twitter. Clearly, things are getting serious!

https://x.com/SlavitescuEuseb/status/1865086770515517741


9,173 posted on 12/06/2024 11:44:52 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9172 | View Replies]

Read what the usual suspects are posting about ;-)


9,174 posted on 12/06/2024 11:46:11 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9173 | View Replies]

To: JonPreston

There is no such thing as the CIA.

NAFO expansion, like NATO expansion, is non-negotiable.


9,175 posted on 12/06/2024 11:47:15 AM PST by BeauBo ( )
[ Post Reply | Private Reply | To 9160 | View Replies]

To: FtrPilot

“Today, Nabiullina’s chief assistant, Denis Vitalyevich Prokhorenko, left Nabiullina’s office amid screams and slamming doors... Two days ago, Denis Vitalievich was fired from the Central Bank.”

The risks and pressures are rising, and the Biden Admin is supposed to drop another big sanctions package before leaving office.

The Russian Central Bank got the ruble below 100 to the dollar today, so they are still intervening hard.

The next Russian Central Bank meeting on interest rates will be 20 December, and balancing the risks is now a real high wire act - economically and politically. Some folks are going out the door now, but others might be out the window later.

OPEC+ decided to extend their production cuts at yesterday’s meeting, but oil prices dropped anyway today. Brent is down to $71, and WTI to $67. Trump said he thought $60 would be fine, and US rig count has already started rising.


9,176 posted on 12/06/2024 12:19:06 PM PST by BeauBo ( )
[ Post Reply | Private Reply | To 9169 | View Replies]

To: BeauBo

Christmas Time in Russia | Relaxing Songs for Holidays

9,177 posted on 12/06/2024 12:58:16 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9175 | View Replies]

To: BeauBo
There is no such thing as the CIA.


9,178 posted on 12/06/2024 1:00:17 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9175 | View Replies]

🔞 The Russian invader unsuccessfully tries to hide behind a tree. Novohrodivka, Donetsk region. Work of the "Dovbush's Hornets" unit of the 68th Jaeger Brigade.

https://x.com/albafella1/status/1865111782643171556


9,179 posted on 12/06/2024 1:36:14 PM PST by FtrPilot
[ Post Reply | Private Reply | To 9168 | View Replies]

To: BeauBo
⚡️🇺🇦 Ukrainian SOF destroy 🇷🇺 Russian logistics in Kursk region

https://x.com/front_ukrainian/status/1865051026149019913


9,180 posted on 12/06/2024 1:43:01 PM PST by FtrPilot
[ Post Reply | Private Reply | To 9176 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 9,141-9,1609,161-9,1809,181-9,200 ... 22,561-22,574 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson