Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

click here to read article


Navigation: use the links below to view more comments.
first previous 1-20 ... 9,021-9,0409,041-9,0609,061-9,080 ... 22,541-22,556 next last
To: JonPreston

Meet Robert Kagan, the husband of Victoria Nuland. A man referred to as the "the chief neoconservative foreign-policy theorist". In the 2016 U.S. presidential election campaign, Kagan left the Republican Party due to the party's nomination of Donald Trump and endorsed Hillary… pic.twitter.com/vypCrgPefa— Briton Man Ideals (@britonmanideals) December 3, 2024

Meet Robert Kagan, the husband of Victoria Nuland. A man referred to as the "the chief neoconservative foreign-policy theorist". In the 2016 U.S. presidential election campaign, Kagan left the Republican Party due to the party's nomination of Donald Trump and endorsed Hillary Clinton.

He was the co-founder of the neoconservative Project for the New American Century, out of the twenty-five people who signed PNAC's founding statement of principles, ten went on to serve in the administration of George W. Bush, including Dick Cheney, Donald Rumsfeld, and Paul Wolfowitz.

In 1998 Kagan advocated regime change in Iraq via articles that were published in the New York Times. Core members of the PNAC including Richard Perle, Paul Wolfowitz, R. James Woolsey, Elliott Abrams, Donald Rumsfeld, Robert Zoellick, and John Bolton were also among the signatories of an open letter initiated by the PNAC to President Bill Clinton calling for the removal of Saddam Hussein. They portrayed Saddam Hussein as a threat to the United States, its Middle East allies, and oil resources in the region, and emphasizing the potential danger of weapons of mass destruction under Iraq's control.

Shortly after the September 11 attacks, the PNAC sent a letter to President Bush, specifically advocating regime change through a determined effort to remove Saddam Hussein from power in Iraq. The letter suggested that any strategy aiming at the eradication of terrorism and its sponsors must include a determined effort to remove Saddam Hussein from power in Iraq, even if no evidence linked Iraq to the September 11 attacks.

Since 2011, Kagan has served on the 25-member State Department's Foreign Affairs Policy Board under Secretaries of State Hillary Clinton and John Kerry.

Kagan has been an early and strong advocate of military action and regime change in Syria, Iran and Afghanistan among others.

In 2008, Kagan wrote an article titled "Neocon Nation: Neoconservatism, c. 1776" for World Affairs, describing the main components of American neoconservatism as a belief in the rectitude of applying US liberalism to the world stage, support for the US to act alone, the promotion of American-style liberty and democracy in other countries, the belief in American hegemony, the confidence in US military power, and a distrust of international institutions.

In 2006, Kagan wrote that Russia and China are the greatest "challenge liberalism faces today": "Nor do Russia and China welcome the liberal West's efforts to promote liberal politics around the globe, least of all in regions of strategic importance to them.

It seems like Kagan’s wife Victoria Nuland put his theories into action at the detriment of Ukraine.


9,041 posted on 12/03/2024 7:53:05 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9039 | View Replies]

https://apnews.com/article/deserters-awol-ukraine-russia-war-def676562552d42bc5d593363c9e5ea0

Desertion threatens to starve Ukraine’s forces at a crucial time in its war with Russia

The troops who walk away

More than 100,000 soldiers have been charged under Ukraine’s desertion laws since Russia invaded in February 2022, according to the country’s General Prosecutor’s Office.

Nearly half have gone AWOL in the last year alone, after Kyiv launched an aggressive and controversial mobilization drive that government officials and military commanders concede has largely failed.

It’s a staggeringly high number by any measure, as there were an estimated 300,000 Ukrainian soldiers engaged in combat before the mobilization drive began. And the actual number of deserters may be much higher.

One lawmaker with knowledge of military matters estimated it could be as high as 200,000.

9,042 posted on 12/03/2024 8:13:10 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9041 | View Replies]

To: AdmSmith; PIF; blitz128; FtrPilot; BeauBo; USA-FRANCE; canuck_conservative; marcusmaximus; ...

I suspect there has probably been some level of corruption or deal making, especially in the early days. As a builder in New York, Trump is probably more aware of this aspect of doing business than most. However, given the level of competency, creativity, and now drone and other military manufacture occurring in Ukraine, I suspect the level of funny business is now rather low. I have discussed the corruption issue with my son, now retired from Special Forces. He fought in Gulf War 1, did 2 tours of fighting season in Afganistan, and another year in the Middle East during the demobilization of Afghanistan. He says a lot of what we in the US consider corruption, in that part of the world is considered normal business practice.

I remember over 50 years ago, while working for an NGO, listening to a discussion among our bookkeepers and accountants. They had a friend who was desperately trying to find out what had happened to 12 US tanks that were missing from inventory.


9,043 posted on 12/03/2024 8:38:22 AM PST by gleeaikin ( Question authority as you provide links)
[ Post Reply | Private Reply | To 9002 | View Replies]

To: gleeaikin
Ukraine's increased electronic warfare efforts are having a marked impact on Russia's homemade Shahed strike drones. And Putin's puppet state of Belarus is far from happy.

Over Oct & Nov, large numbers of drones couldn't reach their targets due to signal interference & Ukraine's now able to redirect drones, to go and attack Russia & Belarus. 😀

https://x.com/GlasnostGone/status/1863862719608238283

This shows that shaheds and ruzzian built shaheds are GPS guided only, not GPS aided INS.

9,044 posted on 12/03/2024 9:44:22 AM PST by FtrPilot
[ Post Reply | Private Reply | To 9043 | View Replies]

To: AdmSmith

Brace for impact in the Russian real estate sector.

The real estate sector has been accounting for about 10% of Russia’s GDP, but it is now nosediving, due to the withdrawal of Government subsidized 8% mortgages in July of 2024, and commercially available mortgages skyrocketing to between 28% (Sherbank’s offer for the most qualified borrowers) and 43%.

Those unlucky borrowers with variable rate mortgages are suddenly being crushed, with required monthly payments growing 2-4 times higher than at the start of the year. Construction has dropped from an annualized 12% growth rate to 0, in just six months.

The Government no longer has the money to bail out the multiple crises developing in the economy, and costs are going to be paid out of the standard of living of the population - broadly and deeply.


9,045 posted on 12/03/2024 11:17:33 AM PST by BeauBo ( )
[ Post Reply | Private Reply | To 9018 | View Replies]

To: BeauBo
With Russia's budget deficit at 3.3 trillion rubles, 21% key interest rate and 2-3 million job vacancies, Russia has to choose between hyperinflation or an economic freeze, says Vladimir Milov, former Deputy Minister of Energy in an interview with Frontelligence Insight 🧵Thread:

https://x.com/Tatarigami_UA/status/1864016510848573762

More information at the link above.

9,046 posted on 12/03/2024 12:56:18 PM PST by FtrPilot
[ Post Reply | Private Reply | To 9045 | View Replies]

To: FtrPilot

Do you know why Biden picked 2014 as the first year of Hunter's pardon?

That's when he was appointed director of Ukraine's Burisma, starting a sequence of events that almost ended in World War 3. And so we go full circle. pic.twitter.com/6CchwEjxtz— zerohedge (@zerohedge) December 2, 2024


9,047 posted on 12/03/2024 1:07:09 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9046 | View Replies]

To: JonPreston

Everyone's talking in late 2024 about Alexander Vindman and treason. Here's what I said on Special Report when Trump fired Vindman from the National Security Council in February of 2020. pic.twitter.com/5gvzB6rwkQ— Mollie (@MZHemingway) November 28, 2024


9,048 posted on 12/03/2024 1:08:22 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9047 | View Replies]

To: JonPreston

9,049 posted on 12/03/2024 1:09:00 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9048 | View Replies]

To: JonPreston

To: Travis McGee

I would rather the world end in nuclear war than yield to Little Pukin.

15 posted on 10/12/2022 4:02:03 AM PDT by SpeedyInTexas (RuZZia is the enemy of all mankind)

9,050 posted on 12/03/2024 1:09:36 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9049 | View Replies]

To: JonPreston

RFK Jr. exposes the truth about the United States proxy war in Ukraine

"It's a money laundering scheme."

pic.twitter.com/UQ8CmOXMuK— BRICS News (@BRICSinfo) November 28, 2024


9,051 posted on 12/03/2024 1:10:51 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9050 | View Replies]

To: gleeaikin; PIF; blitz128; FtrPilot; BeauBo; USA-FRANCE; canuck_conservative; marcusmaximus
Re Martial law in South Korea:

Кремлевская табакерка

“We will not abandon the DPRK in trouble, our valuable specialists will help”

This is how sources in the Ministry of Defense and the Kremlin responded to the escalation of the situation on the Korean Peninsula and the introduction of martial law in South Korea .

“I will not say much. Firstly, the DPRK is our most important partner. So let them sort things out among themselves in Seoul, but leave North Korea alone. Secondly, we have specialists in Pyongyang now, including military ones. Very valuable ones. We will not abandon the DPRK in trouble, if anything, they will help,” said one of the channel's interlocutors. Several other sources confirmed this information. However, they refused to provide any additional details.

It should be noted that rumors about sending a group of our specialists (including military ones) to the DPRK to exchange experience have been circulating for two months. We were then asked not to disclose this information, but now we can report it.

At the same time, some sources still deny the fact of sending specialists from Russia to North Korea.

https://t.me/kremlin_secrets/4985

and

General insulted Belousov for sending our specialists to the DPRK

After this post was published [the one above], a general we know, who is part of Valery Gerasimov’s entourage, contacted us. And he harshly criticized the head of the Ministry of Defense. “I learned from your publication that we sent military specialists to the DPRK. Moreover, we sent them in secret, for example, I did not know about it. I have only one question: is Defense Minister Belousov an idiot? Sending valuable specialists to Korea when part of our Kursk region is still occupied, how is that even possible?” the military man was indignant.

He believes that if this continues, Vladimir Putin will soon think about Belousov’s resignation.

A source in the Ministry of Defense, close to Andrei Removich, commented on these claims as follows: “Everyone knows how important cooperation with the DPRK is for us . Not everyone knows about its scope. And no one needs to know. Therefore, some generals, who only know how to run to the president and beg him for mobilization, should just keep quiet.”

https://t.me/kremlin_secrets/4986

Perhaps the arrival of “Russian specialists” and what they did, as well as the accumulation of North Korean officers earlier in the day, was the dominant factor leading to the declaration of martial law.

9,052 posted on 12/03/2024 1:35:37 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9043 | View Replies]

To: PIF
⚡️Now 🇺🇦 Ukrainian Su-25 attack aircraft can use 🇫🇷 French AASM HAMMER precision-guided bombs

https://x.com/front_ukrainian/status/1864013602241253463


9,053 posted on 12/03/2024 2:04:06 PM PST by FtrPilot
[ Post Reply | Private Reply | To 9046 | View Replies]

To: FtrPilot

“This shows that shaheds and ruzzian built shaheds are GPS guided only, not GPS aided INS.”

What happens when you build and deploy cheap jack drones. They can be nullified by Ukrainian electronic warfare.


9,054 posted on 12/03/2024 4:17:15 PM PST by dennisw
[ Post Reply | Private Reply | To 9044 | View Replies]

TUCKER FROM MOSCOW: "WE'RE IN A HOT WAR WITH RUSSIA AND NOBODY'S TALKING"

Fresh from Moscow, Tucker Carlson drops a bombshell claim: The U.S. military recently killed Russian soldiers on Russian soil, yet most Americans don't know we're essentially at war.

He says there's… pic.twitter.com/68o4Dyn2GP— Mario Nawfal (@MarioNawfal) December 4, 2024


9,055 posted on 12/03/2024 4:55:47 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 9051 | View Replies]

To: dennisw

Noticed lately a lot of drones defeated by EW, makes sense


9,056 posted on 12/03/2024 5:06:35 PM PST by blitz128
[ Post Reply | Private Reply | To 9054 | View Replies]

To: FtrPilot; ETCM; PIF; AdmSmith

Russia evacuating its ships from their Naval Base in Tartus, Syria.

ISW reports today (3 December):

“Russia is evacuating naval assets from its base in Tartus, Syria, which may suggest that Russia does not intend to send significant reinforcements to support Syrian President Bashar al Assad’s regime in the near term.

OSINT analyst MT Anderson reported on December 2 that satellite imagery from November 30 and December 1 showed that the Russian Admiral Gorshkov and Admiral Golovko Gorskhov-class frigates, the Admiral Grigorovich Grigorovich-class frigate, the Novorossiysk Kilo-class submarine, the Yelnya Altay-class oiler, and the Vyazma Kaliningradneft-class oiler were at the Russian base in Tartus. Anderson then reported that satellite imagery from December 3 showed that Russia removed the three frigates, the submarine, and two unnamed auxiliary vessels (likely the Yelnya and Vyazma) from the base — amounting to all of the vessels that Russia had stationed at Tartus.

Russia cannot redeploy these vessels to its Black Sea ports because Turkey is enforcing the Montreux Convention, which prevents Russian warships from passing through the Turkish Straits. Russia will likely therefore redeploy the vessels to its bases in northwestern Russia and Kaliningrad Oblast.

Ukraine’s Main Military Intelligence Directorate (GUR) reported on December 3 that the Russian military command has likely deployed a force grouping of an unspecified size from its Africa Corps — the organization that the Russian Ministry of Defense’s (MoD) created to supplant the Wagner Group’s operations in Africa following Wagner financier Yevgeny Prigozhin’s death in August 2023 — to Syria.

ISW cannot independently confirm reports of Africa Corps elements deploying to Syria, but these reports, if true, would indicate that the Russian military command is avoiding redeploying regular Russian military forces from its priority theater in Ukraine to Syria. The Russian evacuation of Tartus and the reported deployment of Africa Corps forces to Syria suggest that Russia is worried that Syrian opposition forces may advance southward to Hama (roughly 80 kilometers northeast of Tartus) and threaten the Tartus base but that the Russian military command will not deploy significant reinforcements to Syria in the near term to prevent such advances.”


9,057 posted on 12/03/2024 5:24:17 PM PST by BeauBo ( )
[ Post Reply | Private Reply | To 9053 | View Replies]

To: dennisw; FtrPilot
“This shows that shaheds and ruzzian built shaheds are GPS guided only, not GPS aided INS.”

Or really cheap Chinese INS. A decent INS can identify and reject GPS "fixes" that diverge too far from what is expected. I would assume even cheap AI will improve that capability.

9,058 posted on 12/03/2024 5:57:12 PM PST by ETCM (“There is no security, no safety, in the appeasement of evil.” — Ronald Reagan)
[ Post Reply | Private Reply | To 9054 | View Replies]

Russian Offensive Campaign Assessment, December 3, 2024

Russian forces reportedly continued to suffer significant personnel and armored vehicle losses throughout November 2024 as they attempted to maintain intensified offensive operations in eastern Ukraine. Ukrainian military observer Petro Chernyk stated on December 3 that Russian forces are losing 1,700 troops per day and suffered 45,000 total casualties in November 2024.[59] Chernyk assessed that the Russian MoD would have to increase the monthly mobilization rates from 40,000-42,000 to 50,000 in order to seize the entirety of Donetsk Oblast while maintaining their current loss rate. Chernyk noted that the Russian defense industrial base can provide the Russian military with 25 T-90 tanks per month and that Russia currently has 3,000-6,000 armored vehicles in storage, including Soviet-era PT-76 light tanks. Chernyk did not specify if Russia is producing 25 new T-90 tanks per month or if some of these 25 tanks are repaired tanks, and ISW continues to assess that Russia is repairing many of its newer tank models.[60] Chernyk also noted that Russian forces are using tanks with almost no ammunition to transport infantry to the frontline in Kursk Oblast, likely due to 125mm ammunition shortages. Ukrainian Khortytsia Group of Forces Spokesperson Lieutenant Colonel Nazar Voloshyn reported on December 3 that Russian forces suffered almost 9,000 casualties and lost almost 40 tanks in eastern Ukraine over the past week (since roughly November 26).[61] Voloshyn also noted that the Russian military started restaffing “Storm” penal recruit assault groups with female convicts and that Russia is running out of prisoners to recruit into the military. Russian opposition outlet Verstka reported that the Russian 810th Naval Infantry Brigade (Black Sea Fleet [BSF], Southern Military District [SMD]) incurred three times the number of losses in Kursk Oblast compared to any other Russian unit operating in the area and that 71 out of the 350 Russian soldiers that are confirmed missing in action (MIA) in Kursk Oblast served in the 810th Naval Infantry Brigade.[62] ISW has observed reports that the 810th Naval Infantry Brigade has suffered heavy losses during costly frontal assaults in Kursk Oblast.[63] The Russian military command reconstituted the 810th Naval Infantry Brigade several times before suffering significant personnel losses in Kursk Oblast.[64] ISW previously assessed that Russian forces suffered an estimated 80,000 casualties in September and October 2024 and cannot sustain such significant loss rates indefinitely in return for gradual, creeping battlefield gains.[65]

A prominent Russian milblogger claimed on December 3 that the Russian MoD is concerned about reports that some Russian military officials are forcing mobilized Russian soldiers and officers to sign military service contracts and sending those who refuse to sign contracts to conduct infantry-led assaults in Ukraine.[66] The milblogger claimed that Russian Defense Minister Andrei Belousov would not support such coercion. The milblogger previously claimed that former Russian Defense Minister Sergei Shoigu attempted to coopt them in an effort to persuade them to report more favorable information regarding Russia's conduct of its war in Ukraine.[67] The milblogger, however, praised Belousov’s appointment, and the milblogger’s December 3 praise of Belousov, while criticizing other parts of the Russian MoD, suggests that the milblogger views Belousov as separate from the wider problem. ISW has not observed reports of Russian MoD officials addressing these issues, however.

more + maps https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-december-3-2024

9,059 posted on 12/04/2024 12:05:32 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 9016 | View Replies]

To: JonPreston

9,060 posted on 12/04/2024 3:24:46 AM PST by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 9055 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 9,021-9,0409,041-9,0609,061-9,080 ... 22,541-22,556 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson