Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 8,861-8,8808,881-8,9008,901-8,920 ... 22,561-22,565 next last
Germany’s AfD pledges to end Ukraine war as it eyes election breakthrough

Anti-war, anti-migrant rhetoric cheered by crowds in the east as mainstream parties grow concerned about prospects

LINK

8,881 posted on 11/29/2024 7:25:08 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8880 | View Replies]

To: BeauBo
Perhaps the “Ivan Gren” was taken out by a Neptune missile.


8,882 posted on 11/29/2024 7:30:29 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8878 | View Replies]


8,883 posted on 11/29/2024 7:49:43 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8734 | View Replies]


8,884 posted on 11/29/2024 7:50:37 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8883 | View Replies]

To: AdmSmith
1/ The equivalent of an entire regiment – more than 1,000 soldiers, including two lieutenant-colonels – has deserted from a single Russian division.

The huge numbers highlight the normally well-hidden scale of desertions from the Russian army. ⬇️

https://x.com/ChrisO_wiki/status/1862418783098356084

Additional information at the link above.

8,885 posted on 11/29/2024 7:53:23 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8883 | View Replies]

FYI, and your consideration

Unfortunately, many still wrongly believe that Russia are the aggressors.

The US overthrew Ukraine via color revolution, took control via proxy, built a standing army on Russia’s border, supplied them with NATO weapons and training, and are now launching US missiles into Russia.… pic.twitter.com/gloj1fLYTs— Clandestine (@WarClandestine) November 22, 2024


8,886 posted on 11/29/2024 8:05:04 AM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8881 | View Replies]

To: AdmSmith
Some very interesting information WRT Oreshnik IRBM.

If the target was a munitions factory, then all of the warheads missed. Satellite imagery show no damage to any buildings.

Some of the pro ruzzia trolls claimed (on other FR posts) that the warheads hit (and destroyed) an underground weapons storage facility...Of course, this is typical ruzzian BS. The warheads were not penetrator warheads. They were telemetry equipped test warheads. There were no secondary explosions and satellite imagery showed no damage.

I find the pro ruzzia hype to be hilarious. As a missile system of conventional warheads, it is a very expensive way to deliver the equivalent warhead weight that 4 F-16s could deliver.

8,887 posted on 11/29/2024 8:22:00 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8884 | View Replies]

To: PIF
A Russian S-400 air defense location was possibly struck in occupied Crimea near the village of Kurhanne.

The site, previously used for air defense, was abandoned after repeated missile/drone strikes but may have been reoccupied due to its elevated location, ideal for air defense.

https://x.com/NOELreports/status/1862534426539761734

UKF target intel probably had ELINT on an S-400 radar. Boom!

Note the missile trails in the explosion above.

8,888 posted on 11/29/2024 8:44:23 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8887 | View Replies]

To: BeauBo
A USUAL SUSPECT: The recent refinery strike at Rostov used long-range Ukrainian strike drones.

The AQ-400 Scythe is a likely platform, with a range of 750 Km (466 mi) and a cruising speed of 144 Km/ph (108 MPH).

https://x.com/ChuckPfarrer/status/1862347895707472065

Plans to manufacture 500 per month.

I wonder how much damage an AQ-400 Scythe could do to an electric substation.


8,889 posted on 11/29/2024 8:52:25 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8888 | View Replies]

To: PIF
🔥🔥🔥Russia has broken its own record for the number of aviation accidents. In 2024, there have been 208 sudden incidents during takeoff, in flight or during landing.

This is a 30% increase since 2023.

Due to sanctions, a lack of parts is turning flying into Russian Roulette.

https://x.com/officejjsmart/status/1862270690231001382


8,890 posted on 11/29/2024 8:56:28 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8889 | View Replies]

To: marcusmaximus; BeauBo; PIF
Putin is having problems in Syria, Africa, Trump hasn’t been of help, Georgia is revolting, Romania ordered a recount, his troops are getting slaughtered in Ukraine, it’s oil infrastructure is severely damaged and his economy is collapsing.

His response: “I have rocket”

https://x.com/NAFORaccoon/status/1862258326383304782


8,891 posted on 11/29/2024 8:59:02 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8890 | View Replies]

To: PIF
💥💀 Ukrainian FPV drone with thermal imaging strike at a large group of Russian soldiers in the Pokrovsk direction

https://x.com/Maks_NAFO_FELLA/status/1862523457377878255


8,892 posted on 11/29/2024 9:31:22 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8891 | View Replies]

To: FtrPilot

Hopefully, these drone strikes will occur frequently (maybe even daily) from now until Jan 20,2025.


When the strikes intensify over the top.


8,893 posted on 11/29/2024 10:41:12 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8876 | View Replies]

To: FtrPilot

https://en.wikipedia.org/wiki/Ivan_Gren-class_landing_ship


8,894 posted on 11/29/2024 10:43:06 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8871 | View Replies]

To: FtrPilot

Yes, and we shouldn’t reveal anything to the orcs about the effects of their attacks.


8,895 posted on 11/29/2024 10:56:28 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8887 | View Replies]

To: AdmSmith

Track your rubles, currently at 106.5:
https://www.tradingview.com/symbols/USDRUB/


8,896 posted on 11/29/2024 11:10:06 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8895 | View Replies]

To: FtrPilot

Two updates today. One from Torersk and the other from the Kursk directions

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Ukrainians Find a Russian Radio. Create a Brutal Ambush ] 6am


Today [ Nov 29 ], there are a lot of updates from the Toretsk direction. Here, after losing control of half of the tactically important high-rises in the central part of the city, the Russians decided to launch a counterattack to permanently change the dynamics of fighting in Toretsk.

However, the Ukrainians were aware of this plan and readily faced the renewed Russian assaults, fully understanding that whoever controls the central high-rise area, controls the whole city. The Russian plan aimed to assault the Ukrainian-held high-rise buildings to regain complete control over the area.

Success in this objective would allow Russian forces to expand control over residential areas north of the high-rise sector and use them to flank the northern high-rises, intensifying combat there. If achieved, this approach would enable Russian forces to establish comprehensive fire control over all of Toretsk from both high-rise sectors, paving the way for full control of the city.

After nearly a month spent regrouping and reorganizing following previous setbacks in Toretsk, Russian command launched a major infantry assault on Ukrainian positions in the central high-rises. Their plan aimed to overwhelm Ukrainian defenses by swiftly infiltrating and storming the buildings, hoping to force Ukrainian forces into intense close-quarters combat.

The large number of Russian fighters on the ground made them vulnerable to concentrated Ukrainian FPV drone attacks. Many Russian soldiers attempted to evade detection by playing dead, but Lyut Brigade drone operators, familiar with this tactic commonly used by Russian forces in Toretsk, identified and targeted them.

While drones eliminated a substantial portion of the assault units, a considerable number of Russian stormtroopers managed to enter the high-rises and engage Ukrainian forces in combat. Small-arms engagements between Russian and Ukrainian soldiers occurred at extremely close range - just a few dozen meters, sometimes even point-blank - an unusually intense proximity in this war.

The intensity prevented wounded Ukrainian soldiers from receiving immediate treatment, prompting them to continue fighting in hopes of repelling the Russian forces quickly to secure medical aid. Additional footage shows Ukrainian soldiers spotting a Russian stormtrooper on a nearby rooftop attempting to play dead, whom they promptly neutralized.

After exhausting Russian assault forces and inflicting severe losses in the high-rises, Ukrainian fighters retrieved radios from fallen Russian soldiers and used them to communicate with the remaining Russian survivors in Russian.

This tactic lured Russian stormtroopers out of their positions under the impression they were approaching friendly forces, only to be met with concentrated Ukrainian machine gun fire. This strategy allowed Ukrainians to draw Russian troops out of fortified positions, eliminating them without engaging in close-quarters combat.

Overall, the Russians launched a large assault on the Ukrainian positions in the high-rise district of central Toretsk, only to face yet another brutal defeat. After the Ukrainian fighters lured and killed Russians by use of captured radios, the Russian command realized that their communications and coordination among infantry assault squads had been compromised, so they decided to withdraw.

This decision was the only remaining decision that Russian commanders had under the condition of compromised communications, which brought them back to ground zero in terms of their offensive efforts in Toretsk. Losses from this assault will force them to try and reorganize their forces for another few weeks to restart their assaults.


[ Putin is Furious. North Koreans Can’t Even Throw Grenades! ] 8pm

Today [ Nov 29 ], the biggest updates come from the Kursk direction.

Here, in their relentless push against Ukrainian defenses, Russian forces found themselves stalled and in urgent need of reinforcements to sustain their offensive. However, reports on their North Korean allies have just revealed alarming levels of inexperience, nearly causing massive casualties during a simple training exercise, while learning how to use grenades, leaving Russian commanders increasingly desperate for viable solutions.

On the eastern part of the Kursk salient, Russians have recently advanced and reached the Snagost River and are trying hard to cross it. If Russians manage to cross the river, they would cut off a road and critical supply line to Novoivanovka, over which Ukrainians have repelled many Russian assaults on the town.

The only viable location for Russians to establish their bridgehead is in Darino, as the buildings here would give Russians a place to store their supplies and continue their offensive further. Unfortunately for Russians, the river forms a strong natural barrier, and Ukrainians have set up their defense in the settlements and tree lines behind it.

Russian military analysts reported that the most important Ukrainian stronghold here is the farm on top of a hill in Darino, from where Ukrainians have repulsed any Russian attempt at crossing the river.

Even though geolocated footage does show Russian soldiers operating within the town itself, Russians themselves report that Ukrainians already eliminate these assault groups shortly after they cross the river.

As the frontal river crossings had failed, Russians launched a risky flanking operation through the fields from the north, with agile quad bikes to surprise Ukrainian defenders. Despite the quads being smaller and more agile than heavy Russian armored vehicles, they were still detected and destroyed by Ukrainian FPV drones.

Likely, this assault was launched as a probing attack, meant to test Ukrainian defenses for weak spots, testing to see if they could bypass Ukrainian defenses outright.

Still, Russians have not yet launched any larger assaults in this area for several days now. A likely reason for this was that the costly battles up north for Novoivanovka and Malaya Loknya were draining Russian resources, making it difficult for Russians to further intensify their attacks on Darino.

Russian milbloggers critiqued the Russian commanders, as they stated they were destroying the Russian 155th Naval Infantry Brigade themselves by launching constant suicidal attacks on Ukrainian positions.

However, US intelligence reports show that Russians have over 11,000 North Korean soldiers standing in reserve in the Kursk region, which could theoretically continue the Russian offensive. Nevertheless, Russians have seemingly halted all offensive operations on the main Ukrainian salient.

Confessions from several Russian prisoners of war could explain why North Korean troops have not yet been committed to large-scale frontline operations. The Russian prisoners of war state that North Korean soldiers have a severe lack of combat experience. He gives an example of one North Korean soldier nearly killing himself and his training group while learning how to throw a grenade.

They add that North Korean training camps remain strictly off-limits to Russian soldiers and that 1 soldier was nearly shot after he accidentally wandered too close to their encampment. Interestingly, the prisoners were originally from a Storm-V penal battalion, as they confessed they had only received 10 days of training themselves.

The fact that these soldiers already commented on the low training level of North Korean soldiers might explain the unwillingness of Russian commanders to send the North Korean soldiers to the front.

Overall, Russian commanders have pushed the 155th Naval Infantry Brigade to near-complete destruction once again. As recent reports suggest that North Korean soldiers do not have the necessary skills to engage in large-scale combat, Russians have been forced to redeploy over 4,000 soldiers of the 79th VDV Airborne Division from the Zaporizhia region to Kursk.

The additional redeployment of such a large number of forces also shows the scale of the losses Russians have already suffered. Along with the fact that Russians may be unable to fully rely on their North Korean reinforcements to achieve a decisive breakthrough in the future.


8,897 posted on 11/29/2024 11:34:18 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8892 | View Replies]

To: PIF

“rubles, currently at 106.5”

Looks like the Russian Central Bank has been ordered to intervene in the FOREX market, to shore up the ruble again.

Kick the can down the road a little longer...

Their funds are not unlimited.


8,898 posted on 11/29/2024 12:35:44 PM PST by BeauBo
[ Post Reply | Private Reply | To 8896 | View Replies]

To: PIF

“Russian commanders have pushed the 155th Naval Infantry Brigade to near-complete destruction once again.”

I am just gobsmacked by how many times that unit has been attritted to combat ineffective status, and reconstituted with replacements. What is this, like the ninth time, in under three years?

I am not aware of anything comparable in US Military history.


8,899 posted on 11/29/2024 12:43:10 PM PST by BeauBo
[ Post Reply | Private Reply | To 8897 | View Replies]

To: FtrPilot; PIF
Kazakhstan is practically a Russian-speaking country, Putin told Tokayev, president of Kazakhstan.

Tokayev started speaking Kazakh in reply.

https://bsky.app/profile/antongerashchenko.bsky.social/post/3lc45e3dbuc2q
video

28NOV Putin at the CSTO summit in Astana, Kazakhstan.

He doesn't look like a confident leader, certain of himself. In fact, he looks anxious, especially his hands.

https://bsky.app/profile/antongerashchenko.bsky.social/post/3lbyshnkrmc2r

8,900 posted on 11/29/2024 1:19:38 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8895 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 8,861-8,8808,881-8,9008,901-8,920 ... 22,561-22,565 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson