Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 8,781-8,8008,801-8,8208,821-8,840 ... 22,561-22,571 next last
To: AdmSmith; FtrPilot; blitz128

The MOEX (Moscow Exchange) stock market index is denominated in rubles, which as we know, can no longer be considered real money.

For added entertainment during periods of concurrent currency and stock Market crashes, there is also the RTS (Russian Trading System) index of 50 big Russian companies, denominated in actual dollars.

https://www.barchart.com/stocks/quotes/$RTS

A quarter of investors worth has been wiped out in the last two months, and it is accelerating.

Putin did that to them.

Hand them knives.


8,801 posted on 11/27/2024 5:20:30 AM PST by BeauBo
[ Post Reply | Private Reply | To 8792 | View Replies]

To: BeauBo
🚨🇷🇺 🇮🇷 BREAKING: RUSSIA & IRAN have COMPLETELY DEDOLLARIZED their bilateral trade.

https://x.com/LegitTargets/status/1861681372181733683

I wonder how many rubles Iran has.

8,802 posted on 11/27/2024 6:37:01 AM PST by FtrPilot
[ Post Reply | Private Reply | To 8801 | View Replies]

To: FtrPilot

“RUSSIA & IRAN have COMPLETELY DEDOLLARIZED their bilateral trade.”

Just out of dollars. That’s all.


8,803 posted on 11/27/2024 6:52:06 AM PST by BeauBo
[ Post Reply | Private Reply | To 8802 | View Replies]

To: BeauBo

Thanks for the link


8,804 posted on 11/27/2024 9:11:19 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8801 | View Replies]

To: PIF; BeauBo; SpeedyInTexas; FtrPilot; gleeaikin; marcusmaximus; blitz128; ETCM; Monterrosa-24; ...
November 27. INTERFAX.RU - Chairman of the State Duma Committee on Control Oleg Morozov reported at “government hour” on the insufficient staffing of enterprises in the military-industrial complex (ВПК). “It is a given that there is an excess of humanities students and a shortage (of specialists - IF) of engineering specialties that has arisen in recent decades. This fact is especially sensitive for enterprises of the military-industrial complex. According to some estimates, the shortage of specialists here in the near future will amount to about 400 thousand people,” Morozov said on Wednesday.

https://www.interfax.ru/russia/994678

Where have all the specialists gone
Long time passing
Where have all the specialist gone?
Long time ago
Gone for Putin, every one
Oh, when will they ever learn?
Oh, when will they ever learn?

The number today is 735,410

8,805 posted on 11/27/2024 9:43:46 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8804 | View Replies]

The Central Bank decided not to buy currency on the domestic market amid the fall of the ruble.

The Bank of Russia announced its decision not to buy foreign currency on the domestic currency market from November 28 until the end of the year. Currency sales will continue in accordance with previously announced plans in the amount of 8.40 billion rubles per day, the regulator's website says.

The official dollar exchange rate set by the Central Bank for Thursday, November 28, was 108.01 rubles, the euro exchange rate was 113.09 rubles. Compared to Wednesday's rate, the dollar gained 2.95 rubles, the euro — 2.60 rubles.

Finance Minister Anton Siluanov said the day before that the current ruble exchange rate, even if it is already three-digit, is conducive to increasing exports. “I am not saying whether the rate is good or bad. I am simply saying that today the rate for exporters is very, very conducive to exports,” Interfax quoted him as saying.

https://rtvi.com/news/czb-reshil-ne-pokupat-valyutu-na-vnutrennem-rynke-na-fone-padeniya-kursa-rublya/

LOL!

8,806 posted on 11/27/2024 9:49:07 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8791 | View Replies]

Watch this:

PUTIN Official Trailer (2025)

https://www.youtube.com/watch?v=vlxLfHBT5ws

The drama from Polish director Besaleel, also known as Patryk Vega, recreates Russian leader Vladimir Putin using artificial intelligence that was developed in-house with his own technology company AIO, creating what the director terms the “first deepfake” feature film.

https://www.hollywoodreporter.com/movies/movie-news/putin-biopic-ai-appetite-1235895731/

8,807 posted on 11/27/2024 10:00:35 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8806 | View Replies]

To: BeauBo

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view the larger videos. ]

The complete transcript.

[ Caught And Destroyed! Russians Trapped in a Vicious Fire Pocket! ]


Today [ Nov 27 ], there are a lot of updates from the Velyka Novosilka direction.

Here, the Russians launched a series of massive assaults aimed at encircling Velyka Novosilka, pushing hard to break through Ukrainian defenses and gain control. However, overextended logistics and vulnerable supply lines set the stage for the complete decimation of Russian forces, leaving them exposed to precise Ukrainian counterattacks.

Previously, Russian forces advanced toward Rozdolne, north of Velyka Novosilka, securing positions on its southeastern outskirts following intense mechanized assaults. These operations yielded satisfactory results for the Russian command, prompting plans for further offensives.

The capture of fields around Rozdolne bolstered Russian confidence, encouraging flanking maneuvers to the north of Velyka Novosilka. Their objective was to establish physical or at least fire control over two key roads leading to the town, aiming to tighten their grip on the area.

The redeployment of Ukrainian forces from Velyka Novosilka to Kurakhove further motivated the Russians to intensify their operations in the area. The shortage of Ukrainian reserves compelled their command to shift active units from less active sectors to defend Kurakhove, which faced increasing Russian pressure from Kostiantynopil.

Despite this redistribution, the Ukrainian forces remaining in Velyka Novosilka maintained key tactical advantages over the advancing Russian troops, effectively countering the offensive efforts.

To deploy their forces to the frontline, Russian troops must traverse long distances, often moving 10 to 20 kilometers along roads through open fields to reach staging grounds in Shakhtarske and Zolota Nyva. The absence of significant urban settlements in the area denies the Russians adequate cover for their soldiers and equipment. This exposes their columns to Ukrainian FPV drone operators and artillery, who can effectively target these vulnerable movements in the open terrain.

Combat footage from the area shows a Ukrainian strike on a Russian column of six vehicles preparing for an assault 15 kilometers from the front near Novomaiorske. Ukrainian tactics against such armored assault columns involve targeting the lead vehicle to immobilize the column. Once stopped, Ukrainian artillery strikes the trapped vehicles, forcing the crews to abandon them.

These artillery kill zones are predetermined, with Ukrainian drone operators targeting the lead vehicle precisely in these locations, enabling rapid and effective bombardment. Any vehicles that attempt to advance further are subsequently neutralized with drone strikes on critical components, such as the engine, ensuring the assault is thwarted.

The exposure in open fields poses significant challenges not only for Russian assault units, but also for their rear-echelon forces. Ukrainian strikes have successfully targeted Russian artillery and rocket systems, including BM-21 Grad launchers, even in deep rear positions.

These precise attacks suppress Russian fire support, preventing them from effectively softening Ukrainian defenses before assaults. As a result, Russian stormtroopers are forced to engage fortified Ukrainian positions without adequate preparatory support, further diminishing their chances of success.

This is why the Russian command throws wave after wave of Russian mechanized assault groups hoping that a number of survivors from previous assault waves accumulate at assigned positions. This approach enabled the Russian stormtroopers to slip through the eastern part of Rozdolne and initiate local clashes.

Overall, the developments around Rozdolne and Velyka Novosilka highlight a growing pattern of Russian overextension and tactical predictability, contrasted with Ukraine’s ability to exploit terrain and logistical vulnerabilities. While the Russians have managed limited gains, their reliance on exposed mechanized columns and repeated frontal assaults reveals a strategy strained by logistical inefficiencies and a lack of adaptability.

Ukrainian forces, even while redeploying to address threats elsewhere, continue to inflict significant losses, demonstrating their capacity to undermine Russian advances with precision strikes and superior coordination.

The Presidential Brigade of the Armed Forces of Ukraine, 11/23/24
https://t.me/s/opbr_zsu

Destroyed another enemy column in the Vremivsk direction!

In the area of ​​n.p. The enemy regularly conducts assaults in Velika Novosilka. This time he made an attempt to break through with infantry in several directions. And on the site of our 3rd Mechanized Battalion, the occupiers engaged an armored group, which was completely covered by infantry. The column was “met” by the units of the attack UAVs of the Separate Presidential Brigade - “Chimeras”, “Bulava” and “NOVA”.

The entire column was completely destroyed, the equipment was burned to the ground. Many occupiers were eliminated. Those who managed to escape from the hit equipment were finished off with mortars, FPV-kamikaze and skids, as well as the know-how of our unit “Bulava” - a machine gun on a drone.

The video is a vivid example of what modern unmanned vehicles are capable of in the hands of experienced operators with proper use and competent command and control. Separately, we would like to mention the friendly BG of the National Guard for clear interaction, support with intelligence and fire


8,808 posted on 11/27/2024 10:19:27 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8803 | View Replies]

To: AdmSmith

Russian commentators absolutely hate this film. hahahaaha


8,809 posted on 11/27/2024 10:27:26 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 8807 | View Replies]

To: All

Trump taps retired General Keith Kellogg for Ukraine envoy role

https://www.reuters.com/world/us/trump-eyes-retired-general-keith-kellogg-ukraine-envoy-sources-say-2024-11-27/

Former Trump NSC official explains his vision for ending war in Ukraine

https://www.voanews.com/a/former-trump-nsc-official-explains-his-vision-for-ending-war-in-ukraine-/7712184.html


8,810 posted on 11/27/2024 10:29:26 AM PST by marcusmaximus
[ Post Reply | Private Reply | To 8809 | View Replies]

To: marcusmaximus

https://www.armed-services.senate.gov/imo/media/doc/Kellogg_SASC%20Hearing%20Written%20Testimony_28%20Feb%202023%20(003).pdf


8,811 posted on 11/27/2024 10:41:39 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8810 | View Replies]

To: AdmSmith
It is no mystery why this war happened. The Russian dictator, Vladimir Putin, has always resented the American victory in the Cold War, and has spoken openly of his desire to reverse it.
8,812 posted on 11/27/2024 10:43:52 AM PST by marcusmaximus
[ Post Reply | Private Reply | To 8811 | View Replies]

To: PIF
🔥🇺🇦 Ukrainian SOF captured a huge group of 🇷🇺 Russian marines in Kursk Region

During special operations, they also caused significant losses to the enemy.

Symbolically that several dozen soldiers of the 810th Russian Marine Brigade were captured on the Day of the Russian Marines

https://x.com/GloOouD/status/1861840730534072759


8,813 posted on 11/27/2024 12:18:18 PM PST by FtrPilot
[ Post Reply | Private Reply | To 8809 | View Replies]

To: AdmSmith; BeauBo; All

8,814 posted on 11/27/2024 12:19:49 PM PST by FtrPilot
[ Post Reply | Private Reply | To 8813 | View Replies]

To: AdmSmith; PIF; BeauBo; SpeedyInTexas; FtrPilot; gleeaikin; marcusmaximus; blitz128; ETCM; ...

A promise was made to the Russians, but NATO decided to move its border 1000 km to the East.

That is not without consequences.

Brainwashed Ukrainians are now paying with their lives.

Play stupid games, win stupid prizes..... pic.twitter.com/jr7u4hIEuj— Richard (@ricwe123) November 24, 2024


8,815 posted on 11/27/2024 3:53:28 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8805 | View Replies]

To: JonPreston

Memorandum of conversation is that like Soviet Union and Russia agreeing to Ukrainian sovereignty in an actual agreement?


8,816 posted on 11/27/2024 4:11:15 PM PST by blitz128
[ Post Reply | Private Reply | To 8815 | View Replies]

To: JonPreston; PIF; BeauBo; blitz128; Magnum44; ansel12; ETCM; marcusmaximus; AdmSmith
Jon,

Here's a link to the constitution of the United States of America.

https://constitution.congress.gov/constitution/

Please cite the paragraph in the U.S. Constitution that authorizes the Secretary of State to make a "promise" to a country.

This "Memo of Conversation" was made with a country that does not exist.

Gorbechev has admitted that NATO expansion was NOT a condition or premise for unification of Germany.

8,817 posted on 11/27/2024 4:29:44 PM PST by FtrPilot
[ Post Reply | Private Reply | To 8815 | View Replies]

To: FtrPilot

The other 15 members of NATO of the time would have also had to formally agree to and ratify such a NATO treaty.


8,818 posted on 11/27/2024 4:42:44 PM PST by ansel12 ((NATO warrior under Reagan, and RA under Nixon, bemoaning the pro-Russians from Vietnam to Ukraine.))
[ Post Reply | Private Reply | To 8817 | View Replies]

To: FtrPilot

jeez FtrPilot, it’s called diplomacy. But on second thought it’s called NATO diplomacy.


8,819 posted on 11/27/2024 6:33:16 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8817 | View Replies]

To: blitz128
is that like Soviet Union and Russia agreeing to Ukrainian sovereignty in an actual agreement?

Present your evidence dimwit. I'll be waiting over here by the turkey.

8,820 posted on 11/27/2024 6:35:12 PM PST by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 8816 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 8,781-8,8008,801-8,8208,821-8,840 ... 22,561-22,571 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson